...beta-globin intron, for pCAG plasmids, forward primer pCasper-F GGGTTTTATTAACTTACAT (Vosshall lab) 5' end of ...of Drosophila mini-white gene, reverse primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter...

...information on the wide variety of Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with...activity, experimental considerations, and more. CasPEDIA is a community resource created and maintained...expression of gRNAs Single Base Editing with CRISPR CasPEDIA: A Functional Classification of Cas Enzymes Cas...