...the Innovative Genomics Institute. What is CasPEDIA? CasPEDIA is an online, searchable resource that provides...a quick overview of each CasPEDIA feature. Activity features: CasID CasPEDIA will display both the cis...plasmids, Addgene and CasPEDIA have got you covered!     Fig. 1 – CasPEDIA Cas ID display information...for a Cas entry (SpyCas9a) from CasPEDIA.   How can I use it? CasPEDIA operates like many search engines...and embrace a new resource to solve the problem: CasPEDIA, a new resource from Jennifer Doudna’s lab at ...established uses, and intended applications. Within CasPEDIA, there is a classification system, CasID, to help...facilitate direct comparison of different enzymes. CasPEDIA is meant to be a constantly updating database ...

...activate a cascade of caspases, protease enzymes that cleave proteins. Executioner caspases are activated last... executioner caspase reporters. In these reporters, the FRET pair is linked by a caspase cleavage site...one of the linkers is a consensus caspase-3 (an executioner caspase) cleavage site (DEVD). Upon cleavage...used genetically encoded fluorescent executioner caspase reporters. Several apoptosis reporters have been...site. Cutting the linker by a caspase results in a change in fluorescence emission. FRET and fluorescence...Studying apoptosis in vivo using the FlipGFP-based caspase reporter The Shu Lab successfully used FlipGFP ...staurosporine, which induces apoptosis by activating caspase-3, and detected fluorescence within 2 to 5 hours...

...specific genomic locus: Caspex  Article contributed by Susanna Bachle  Listen to the Caspex podcast segment ... proteins with biotin as an affinity tag. This ‘Caspex’ construct is guided by a pre-defined sgRNA sequence...at your locus of choice. Find the Tet-inducible caspex plasmid here. Myers SA et al. Nature Methods. ...

...(Mouse IgG2a) Goat anti-mouse IgG2a CASPR anti-CASPR mAb K65/35 (Mouse IgG1) Goat anti-mouse...Neocortex labeled with anti-pan-Nav (magenta), anti-CASPR (green), and anti-Kv2.1 (cyan). (B) Cerebellum labeled...

... for a knock-out in your experiments? AAV-flex-taCasp3-TEVp from Nirao Shah's and Jim Well's lab induces...use viral prep in serotype AAV5. Find AAV-flex-taCasp3-TEVp here The red-shifted channelrhodopsin (C1V1...

...validation data on Addgene/CLOVER viral vectors.  Caspedia: A data repository for Cas enzymes.  Open repository...

... is not suitable for use in apoptotic cells as Caspase3/7 both cleave after the DVPD sequence. Check out...

...over to our CRISPR Plasmids and Resources page.  CasPhi is 70 kDa Cas protein identified exclusively in...

... encyclopedia of Class 2 CRISPR systems called CasPEDIA, with information about enzyme activity, experimental...

...Anti-CASPR/Neurexin IV [K65A/2R] CASPR/Neurexin IV Mouse IgG2a 206606 Anti-CASPR2 [K67/11R] CASPR2 Human...177445 Anti-CASPR/Neurexin IV [K65/35R] CASPR/Neurexin IV Rat Mouse IgG2a 177446 Anti-CASPR2 [K67/25R] ...219448 Anti-CASPR/Neurexin IV [K65A/30R] CASPR/Neurexin IV Rat Mouse IgG2a 219449 Anti-CASPR/Neurexin IV...SAP97 Rat Mouse IgG2a 128625 Anti-CASPR/Neurexin IV [K66/38R] CASPR/Neurexin IV Rat Mouse IgG2a 128626...VAPA Rat Mouse IgG2a 199403 Anti-CASPR/Neurexin IV [K65/35R-2b] CASPR/Neurexin IV Rat Mouse IgG2b 199404...external) Human Mouse IgG1 206683 Anti-CASPR/Neurexin IV [K65/35R-1] CASPR/Neurexin IV Rat Mouse IgG1 206684...K28/77R] PSD-95 Human Mouse IgG2a 220381 Caspr [K65/31R] Caspr Rat Mouse IgG2a 220382 KChIP3 K+ channel...

...domain death agonist CASP3 Caspase 3, apoptosis-related cysteine peptidase CASP8 Caspase 8, apoptosis-related...apoptosis-related cysteine peptidase CASP9 Caspase 9, apoptosis-related cysteine peptidase Cyclin B CCNB1 CCNB2 CCNB3...

...cell ablation. 2 Jessell , Azim 45580 pAAV-flex-taCasp3-TEVp EF1a-driven, Cre-dependent Cre-dependent, ..., bicistronic expression of designer pro-taCasp3 and TEVp for studying cell ablation. 5 Shah , Wells Don...

... for Genomic Deletions in Mammalian Cell Lines CasPEDIA : An encyclopedia of Class 2 CRISPR systems with...activity, experimental considerations, and more. CasPEDIA is a community resource created and maintained...

...Bertagnolli D, Bowlus J, Boyer G, Brouner K, Casian B, Casper T, Chakka AB, Chakrabarty R, Chance RK, Chavan ...Mortrud M, Chong P, Loftus L, Bertagnolli D, Goldy J, Casper T, Dee N, Opitz-Araya X, Cetin A, Smith KA, Gwinn...

...beta-globin intron, for pCAG plasmids, forward primer pCasper-F GGGTTTTATTAACTTACAT (Vosshall lab) 5' end of ...of Drosophila mini-white gene, reverse primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter...

...information on the wide variety of Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with...activity, experimental considerations, and more. CasPEDIA is a community resource created and maintained...expression of gRNAs Single Base Editing with CRISPR CasPEDIA: A Functional Classification of Cas Enzymes Cas...

...information on the wide variety of Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with...activity, experimental considerations, and more. CasPEDIA is a community resource created and maintained...expression of gRNAs Single Base Editing with CRISPR CasPEDIA: A Functional Classification of Cas Enzymes Cas...

...BRAF1, FLJ95109, MGC126806, MGC138284, RAFB1 CASP3 caspase 3, apoptosis-related cysteine peptidase CPP32...IMD1, MGC126261, MGC126262, PSCTK1, XLA CARD11 caspase recruitment domain family, member 11 BIMP3, CARMA1...lymphoma 10 CARMEN, CIPER, CLAP, c-E10, mE10 CARD11 caspase recruitment domain family, member 11 BIMP3, CARMA1...

...information on the wide variety of Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with...

...information on the wide variety of Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with...