We narrowed to 3 results for: Eomes
-
TypeGuide... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...
-
Antibody Guide
TypeGuide...done using methods such as transcriptomics or proteomics. This approach is often appropriate for quantitative...validation This method uses peptide identification by proteomics (Capture MS) to validate the identity of proteins... -
Optogenetics Guide
TypeGuide...Red-shifted chloride-conducting channel from Proteomonas sulcata 540 Phobos Blue-shifted iC++ variant ...