Skip to main content

We narrowed to 3 results for: RCA

Showing: 1 - 3 of 3 results
  1. Adenovirus Guide

    Type
    Guide
    ...production of replication-competent adenoviruses (RCAs) that would be able to infect cells and replicate...production, and higher titers. However, the risk of RCA formation is higher for first-generation rAdV vectors...exposed. There is a risk of spontaneous reversion to RCAs, although this has been reduced by providing the...adenovirus and replication-competent adenovirus (RCA) contaminants . Experimental & Molecular Medicine...material into cells. Replication-competent adenovirus (RCA) Mutated adenoviral vector that has the ability to...
  2. Sequencing Primers

    Type
    Guide
    ...TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV) Reverse RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG 3' of Rous sarcoma ...
  3. CRISPR Guide

    Type
    Guide
    ...size as SaCas9, with higher fidelity than SpCas9. FrCas9 (from Faecalibaculum rodentium ) has increased ... Lang, B., Meng, B., Weng, H., & Hu, Z. (2022). FrCas9 is a CRISPR/Cas9 system with high editing efficiency...
Showing: 1 - 3 of 3 results