We narrowed to 4 results for: RCA
-
TypeGuide...production of replication-competent adenoviruses (RCAs) that would be able to infect cells and replicate...production, and higher titers. However, the risk of RCA formation is higher for first-generation rAdV vectors...exposed. There is a risk of spontaneous reversion to RCAs, although this has been reduced by providing the...adenovirus and replication-competent adenovirus (RCA) contaminants . Experimental & Molecular Medicine...material into cells. Replication-competent adenovirus (RCA) Mutated adenoviral vector that has the ability to...
-
Sequencing Primers
TypeGuide...TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab) 3' of... -
Optogenetics Guide
TypeGuide...Increased photocurrent amplitude Examples: iChloC, SwiChRca, Phobos, Aurora Browse Channelrhodospin plasmids...mutations E90R, D156N, T159C, CE83Q & E101S 465 SwiChRca Chloride-conducting channel, Step-waveform inhibitory... -
CRISPR Guide
TypeGuide...size as SaCas9, with higher fidelity than SpCas9. FrCas9 (from Faecalibaculum rodentium ) has increased ... Lang, B., Meng, B., Weng, H., & Hu, Z. (2022). FrCas9 is a CRISPR/Cas9 system with high editing efficiency...