We narrowed to 44 results for: RCA
-
TypeBlog Post...Importantly, recombination-competent adenovirus (RCA) can be generated if the E1 gene from the packaging...therefore recommended to test for the presence of RCA in the viral stock by doing a plaque formation assay...are commercially available for faster detection of RCA. 2nd Gen AdVs were designed to have increased cloning...capacity, decreased potential for the generation of RCA and reduced immunogenicity. In addition to E1/E3,...
-
Adenovirus Guide
TypeGuide...production of replication-competent adenoviruses (RCAs) that would be able to infect cells and replicate...production, and higher titers. However, the risk of RCA formation is higher for first-generation rAdV vectors...exposed. There is a risk of spontaneous reversion to RCAs, although this has been reduced by providing the...adenovirus and replication-competent adenovirus (RCA) contaminants . Experimental & Molecular Medicine...material into cells. Replication-competent adenovirus (RCA) Mutated adenoviral vector that has the ability to... -
Sequencing Primers
TypeGuide...TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab) 3' of... -
Biosensor AAV Preps
TypeCollection...Griesbeck Calcium Sensor: jRCaMP1 100846 pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40 CAG jRCaMP1a none Cre dependent...dependent 1 Kim , GENIE 100848 pAAV.Syn.NES.jRCaMP1a.WPRE.SV40 Syn jRCaMP1a none Constitutive 1, 9 Kim , GENIE...GENIE 100849 pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 CAG jRCaMP1b none Cre dependent 1 Kim , GENIE 100850 pAAV.Syn.Flex.NES-jRCaMP1b.WPRE.SV40... pAAV.Syn.Flex.NES-jRCaMP1b.WPRE.SV40 Syn jRCaMP1b none Cre dependent 1 Kim , GENIE 100851 pAAV.Syn.NES-jRCaMP1b.WPRE.SV40...pAAV.Syn.NES-jRCaMP1b.WPRE.SV40 Syn jRCaMP1b none Constitutive 1, 9 Kim , GENIE Calcium Sensor: jYCaMP1 135420 ...jYCaMP1 axon-jYCaMP1 Red Calcium Sensors CaMPARI jRCaMP1 jRGECO1 sRGECO Far-Red/NIR Calcium Sensors HaloCaMP1a... -
Penn Vector Core Partnership with Addgene
TypeCollection...AV-1-PV3850 100849-AAV1 pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3851 ...PV3851 100850-AAV1 pAAV.Syn.Flex.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3852 100851-AAV1...AAV1 pAAV.Syn.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3853 100846-AAV1 pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40...pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3855 100848-AAV1 pAAV.Syn.NES.jRCaMP1a.WPRE.SV40... Kim AV-9-PV3852 100851-AAV9 pAAV.Syn.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-9-PV3855 ...PV3855 100848-AAV9 pAAV.Syn.NES.jRCaMP1a.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-9-PV4365 107790-AAV9 AAV.CamKII.GCaMP6s.WPRE.SV40...AV-1-PV3854 100847-AAV1 pAAV.Syn.Flex.NES-jRCaMP1a.WPRE.SV40 GENIE, Douglas Kim AV-10-18917P 18917-AAV1... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Calcium Red Calcium indicators based on mRuby (jRCaMP1a, jRCaMP1b) and mApple (jRGECO1a) (Constitutive or Cre-dependent... Iino Calcium Red fluorescent calcium sensors (fRCaMP1/2, GECO1/2) The kinetic mechanisms of fast-decay....0 Project Calcium Mitochondrial and cytosolic RCaMP1h calcium sensors, ER-targeted CEPIA1er ER-mitochondria...Masseck Calcium Astrocyte AAV-mediated expression of jRCaMP1a, a red fluorescent calcium sensor Using Genetically...name, target, publication title or keywords (e.g. "RCaMP", "caspase", "mTORC1", "mitochondria"). ID Plasmid... -
Hot Plasmids - June 2020 - Barcoded CRISPR Library, Sparse Cell Labeling, Calcineurin Reporter, and DNA Staining Dye Alternative
TypeBlog Post...al., 2019. Looking for an alternative to intercalating fluorescent dyes for DNA-protein interaction...tTALE-eGFP and tTALE-mCherry. In comparison to intercalating fluorescent dyes which can cause photo-induced... -
Quantifying DNA? Here are Five DNA Quantification Methods to Consider
TypeBlog Post... start by pouring your gel containing a DNA intercalating dye (ex: ethidium bromide) and choosing a DNA...quantified over time using a fluorescent dye that intercalates into the DNA such that smaller fragments are... -
Why and how to start studying chromatin (with Addgene's help)
TypeBlog Post...Chromatin-related genes with plasmids on Addgene.org AGO1 BRCA1 CREBBP CUL1 H2AFX H2AFY H3F3A H3.1 H3.3 HIST1H1E... favorite gene! SWI/SNF Genes: BRG1(SMARCA4) BAF170 (SMARCC2) ARID1A Chromatin research... -
3 Challenges in Plant Synthetic Biology
TypeBlog Post...components: the pigments (anthocyanins), and the plant circadian clock. Petunias have been a model organism for...characterized mechanisms and components of the circadian rhythm in petunias. Because of the extensive research... -
Announcing the Winners of the 2021 Michael Davidson and Roger Tsien Commemorative Conference Awards
TypeBlog Post...enzyme hydropersulfide-propagating enzymes 3-mercaptopyruvate sulfurtransferase (MPST) which catalyzes the... the desulfuration of 3-mercaptopyruvate and generates an enzyme-bound hydropersulfide that is then transferred... -
Antibody Validation for Flow Cytometry
TypeBlog Post..., D., McDowell, I., Southern, K., Reintsch, W., Durcan, T. M., Brown, C., Bandrowski, A., Virk, H., Edwards...., Benaliouad, F., Gileadi, O., McBride, H. M., Durcan, T. M., Edwards, A. M., Healy, L. M., Robertson... -
Technical Design of a Western Blot
TypeBlog Post...are not with denaturing agents like DTT or β-mercaptoethanol. Denaturing proteins To denature your proteins...you'll want to use SDS and either DTT or β-mercaptoethanol (BME). DTT is a stronger reducing agent than... -
Trimmer Lab NeuroMab Collection
TypeCollection...15R] BAF53b Human Mouse IgG2a 177534 Anti-NrCAM [N343/26R] NrCAM Mouse Mouse IgG2a 177535 Anti-Kir6.2 K+...mouse) IgG2b 231817 NrCAM (Mus musculus) recombinant mouse monoclonal antibody NrCAM Mouse M. musculus ... -
Plasmids 101: How to Name Your Plasmid in 3 Easy Steps
TypeBlog Post...contains and other important information. Tip: A lowercase "p" is often used as the first letter of a plasmid... -
Western Blot
TypeProtocol...Microcentrifuge tubes BCA Assay, Thermo Fisher 23227 β-mercaptoethanol 4X protein loading buffer Precast SDS-PAGE ...sample for loading as follows: Add 10% v/v β-mercaptoethanol to the 4X protein loading buffer. Dilute 4X... -
CRISPR 101: Drug discovery and CRISPR
TypeBlog Post...example, let’s say you identified gene target X for BRCA-deficient breast cancer and identified several candidate... -
Hot Plasmids - September 2019 - CRISPR, Auxin Inducible Degradation, MerMAID Channelrhodopsins, and Genome Looping
TypeBlog Post...: 31026591. Expanding the targeting range of CRISPRCas9 by engineering SpCas9 Article contributed by ... -
Developing a cold tolerant E. coli using specialized chaperones
TypeBlog Post...aggregate or precipitate out as insoluble granules. We overcame this problem by engineering a plasmid which contained... -
OCaMP: A New Calcium Indicator for Neural Imaging
TypeBlog Post...fluorescence, while red indicators jRGECO1a and jRCaMP1a are widely used as well. To complement these tools...