Skip to main content
Addgene
Showing: 1 - 20 of 45 results

  1. Adenoviral Vector Production and Troubleshooting

    Type
    Blog Post
    ...Importantly, recombination-competent adenovirus (RCA) can be generated if the E1 gene from the packaging...therefore recommended to test for the presence of RCA in the viral stock by doing a plaque formation assay...are commercially available for faster detection of RCA. 2nd Gen AdVs were designed to have increased cloning...capacity, decreased  potential for the generation of RCA and reduced immunogenicity. In addition to E1/E3,...

  2. Adenovirus Guide

    Type
    Guide
    ...increases with each round of amplification. What is RCA? RCA stands for r eplication c ompetent a denovirus...

  3. Sequencing Primers

    Type
    Guide
    ...TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab) 3' of...

  7. 3 Challenges in Plant Synthetic Biology

    Type
    Blog Post
    ...components: the pigments (anthocyanins), and the plant circadian clock. Petunias have been a model organism for...characterized mechanisms and components of the circadian rhythm in petunias. Because of the extensive research...

  9. Biosensor AAV Preps

    Type
    Collection
    ...Griesbeck Calcium Sensor: jRCaMP1 100846 pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40 CAG jRCaMP1a none Cre dependent...dependent 1 Kim , GENIE 100848 pAAV.Syn.NES.jRCaMP1a.WPRE.SV40 Syn jRCaMP1a none Constitutive 1, 9 Kim , GENIE...GENIE 100849 pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 CAG jRCaMP1b none Cre dependent 1 Kim , GENIE 100850 pAAV.Syn.Flex.NES-jRCaMP1b.WPRE.SV40... pAAV.Syn.Flex.NES-jRCaMP1b.WPRE.SV40 Syn jRCaMP1b none Cre dependent 1 Kim , GENIE 100851 pAAV.Syn.NES-jRCaMP1b.WPRE.SV40...pAAV.Syn.NES-jRCaMP1b.WPRE.SV40 Syn jRCaMP1b none Constitutive 1, 9 Kim , GENIE Calcium Sensor: jYCaMP1 135420 ...jYCaMP1 axon-jYCaMP1 Red Calcium Sensors CaMPARI jRCaMP1 jRGECO1 sRGECO Far-Red/NIR Calcium Sensors HaloCaMP1a...

  10. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...AV-1-PV3850 100849-AAV1 pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3851 ...PV3851 100850-AAV1 pAAV.Syn.Flex.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3852 100851-AAV1...AAV1 pAAV.Syn.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3853 100846-AAV1 pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40...pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3855 100848-AAV1 pAAV.Syn.NES.jRCaMP1a.WPRE.SV40... Kim AV-9-PV3852 100851-AAV9 pAAV.Syn.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-9-PV3855 ...PV3855 100848-AAV9 pAAV.Syn.NES.jRCaMP1a.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-9-PV4365 107790-AAV9 AAV.CamKII.GCaMP6s.WPRE.SV40...AV-1-PV3854 100847-AAV1 pAAV.Syn.Flex.NES-jRCaMP1a.WPRE.SV40 GENIE, Douglas Kim AV-10-18917P 18917-AAV1...

  11. Antibody Validation for Flow Cytometry

    Type
    Blog Post
    ..., D., McDowell, I., Southern, K., Reintsch, W., Durcan, T. M., Brown, C., Bandrowski, A., Virk, H., Edwards...., Benaliouad, F., Gileadi, O., McBride, H. M., Durcan, T. M., Edwards, A. M., Healy, L. M., Robertson...

  12. Technical Design of a Western Blot

    Type
    Blog Post
    ...are not with denaturing agents like DTT or β-mercaptoethanol.  Denaturing proteins To denature your proteins...you'll want to use SDS and either DTT or β-mercaptoethanol (BME). DTT is a stronger reducing agent than...

  13. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Calcium Red Calcium indicators based on mRuby (jRCaMP1a, jRCaMP1b) and mApple (jRGECO1a) (Constitutive or Cre-dependent... Iino Calcium Red fluorescent calcium sensors (fRCaMP1/2, GECO1/2) The kinetic mechanisms of fast-decay....0 Project Calcium Mitochondrial and cytosolic RCaMP1h calcium sensors, ER-targeted CEPIA1er ER-mitochondria...Masseck Calcium Astrocyte AAV-mediated expression of jRCaMP1a, a red fluorescent calcium sensor Using Genetically...name, target, publication title or keywords (e.g. "RCaMP", "caspase", "Dynamic Visualization of mTORC1 Activity...

  15. Western Blot

    Type
    Protocol
    ...Microcentrifuge tubes BCA Assay, Thermo Fisher 23227 β-mercaptoethanol 4X protein loading buffer Precast SDS-PAGE ...sample for loading as follows: Add 10% v/v β-mercaptoethanol to the 4X protein loading buffer. Dilute 4X...

  19. Working with Nuclear Receptors

    Type
    Blog Post
    ...different tissues in normal and disease states, their circadian regulation, as well as in important physiological...
Showing: 1 - 20 of 45 results