Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 1 of 1 results

  1. Sequencing Primers

    Type
    Guide
    ...primer Luc-F AGTCAAGTAACAACCGCGA 3' end of luciferase, forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of...primer M13 (-21) Forward TGTAAAACGACGGCCAGT In lacZ gene M13 (-40) GTTTTCCCAGTCACGAC In lacZ gene M13 Reverse...Human U6 promoter, forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 ...AUG1 promoter, forward primer AUG1 Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1...AUG1 promoter, reverse primer BGH Reverse TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator...terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) Drosophila heat shock promoter...promoter, forward primer EF-1a Forward TCAAGCCTCAGACAGTGGTTC (Invitrogen) Human elongation factor-1a promoter...
Showing: 1 - 1 of 1 results