Skip to main content

We narrowed to 4 results for: c-MYC

Showing: 1 - 4 of 4 results
  1. Sequencing Primers

    Type
    Guide
    ...Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin resistance...CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N...transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG 3' end of DsRed1 Forward ... Human elongation factor-1α promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N...Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F TGGCTCTCCTCAAGCGTATT...3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance...gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse NOS-F GCGTTCAAAAGTCGCCTAAG...
  2. Molecular Biology Reference

    Type
    Guide
    ... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...Thymine (T), Cytosine (C) and Guanine (G). In the double helix, A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK or DLYDDDDK...thymine, cytosine, and guanine (abbreviated to A, T, C, and G, respectively). The bases are organized into... hydrogen bonds, where A always pairs with T, and C always pairs with G. The order of nucleotides makes...vitro DNA replication in addition to the normal A, T, C, or G nucleotides. The four standard bases (dNTPs)...
  3. Lentiviral Vector Guide

    Type
    Guide
    .... M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...PMID: 33768124 Marshall, H. M., Ronen, K., Berry, C., Llano, M., Sutherland, H., Saenz, D., Bickmore, ...PMID: 18092005 Merten, O., Hebben, M., & Bovolenta, C. (2016). Production of lentiviral vectors. Molecular...Schambach, A., Zychlinski, D., Ehrnstroem, B., & Baum, C. (2013). Biosafety features of lentiviral vectors....., Kochenderfer, J. N., Norberg, S. M., Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R.... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...
  4. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Wong, G. K., Cameron, E. R., Kilbey, A., & Neil, J. C. (2016). Gamma-Retrovirus integration marks cell Type-Specific...10.1371/journal.pone.0154070 PMID: 27097319 LaFave, M. C., Varshney, G. K., Gildea, D. E., Wolfsberg, T. G....gkt1399 PMID: 24464997 Maetzig, T., Galla, M., Baum, C., & Schambach, A. (2011). Gammaretroviral vectors:...Rubat, L., Nikoniuk, A., Macmorland, W., Horlock, C., Matsumoto, S., Williams, S., Smith, K., Price, J... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...
Showing: 1 - 4 of 4 results