We narrowed to 24 results for: c-MYC
-
TypeCollection...state using a cocktail of factors (Oct3/4, Sox2, c-Myc, and Klf4) that are known to maintain pluripotency...Doxycycline-inducible expression of human Oct4, Sox2, Klf4, and c-Myc from four separate lentiviral plasmids A drug-inducible...for the expression of human Oct4, Klf4, Sox2, and c-Myc Human Induced Pluripotent Stem Cells Produced Under... vector for the expression of human Oct4, Klf4, c-Myc, and Sox2 Integrative Analyses of Human Reprogramming...Lentivirus Human Expression of human Klf4, Oct4, c-Myc, and Sox2 as VP-16 transcriptional activating fusions...polycistronic expression of human Oct4, Klf4, Sox2, c-Myc and hairpin RNA p53 for single plasmid reprogramming...retroviral expression of human Sox2, Oct3/4, Klf4, and c-Myc from four separate plasmids Induction of pluripotent...
-
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early ...pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling...-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc ...pCMV-mGold-Tubulin-C-18 Microtubules alpha-tubulin mGold Francois St-Pierre 158009 pCMV-mGold-Actin-C-18 Actin ... NLS mKalama1 Robert Campbell 73205 pcDNA3.1-NLS-myc-dL5-2xG4S-mCer3 Nucleus NLS (from Mak16p protein)...p63 mTurquoise2 Dorus Gadella 73206 pcDNA3.1-kappa-myc-dL5-2xG4S-TMst Cell surface (mammalian) PDGFR-derived...SKL mNeonGreen Dorus Gadella 73210 pcDNA3.1-KozATG-myc-dL5-2XG4S-mCer3-SKL Peroxisome SKL tripeptide, peroxisome... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...display vector with a C-terminal Myc tag pPMW-attB - pUASp plasmid with N-terminal Myc tag and attB for Drosophila...N-terminal Myc tag for mammalian expression pGEX-4T-1-3xMyc - Bacterial vector for Myc tag pETcon(-) - Yeast...vector for C-terminal 3x HA tag fusion with your gene of interest in plants Myc Epitope tag pKMyc - N-terminal...transgenesis His Epitope tag pEZYmyc-His - C-terminal Myc-His tag for mammalian expression...backbone, mammalian expression pENTR4-myc-nuc - pEntry vector that adds a C-terminal nuclear localization signal...MCS-BioID2-HA or myc-BioID2-MCS - To fuse your protein of interest to the N-terminus or C-terminus of BioID2... Backbones Flag Epitope tag c-Flag pcDNA3 or FLAG-HA-pcDNA3.1 - C-terminal Flag or N-terminal FLAG-HA... -
Neurodegeneration Plasmid Collection
TypeCollection...pCMVTNT PINK1 N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's...Ultra-Exon1Q23-Myc-A HTT Myc UbC Huntington's Baoji Xu 110487 Ultra-Exon1Q145-Myc-A HTT Myc UbC Huntington's...pUltra-Exon1Q23-Myc-B HTT Myc UbC Huntington's Baoji Xu 110489 pUltra-Exon1Q145-Myc-B HTT Myc UbC Huntington's...Strep-Lrrk2-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161583 pPuro3.1(+)_Strep-Lrrk2-Myc LRRK2 Myc, Strep...LRRK2-WT LRRK2 His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted ... pGW1-Myc-DJ1-WT PARK7 V5 CMV Parkinson's Mark Cookson 29349 pGW1-Myc-DJ1-L166P/K130R PARK7 Myc CMV Parkinson's...D1994S)-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161585 pPuro3.1(+)_Strep-Lrrk2(G2019S)-Myc LRRK2... -
Luciferase Plasmid Collection
TypeCollection...five transcriptional reporters for NF-kb, TGF-b, c-Myc, p53, and MAPK/JNK plus a constitutive control. ...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning. Lentival...Alberto Macho 174051 pGWB-cLUC Firefly Creation of C-terminal Fifrefly luciferase fragment for split-luciferase...fusing NanoLuc® and Venus fluorophore to Troponin C Ca 2+ binding domain. Luminopsins : Luciferase-opsin...FRB-Nluc : Split firefly luciferase reporter of rapamycin-inducible interaction. nLuc and cLuc : Constructs... -
Tetracycline Inducible Expression
TypeCollection...opens in a new window) Krueger, C., Pfleiderer, K., Hillen, W., & Berens, C. (2004). Tetracycline derivatives...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...vector to express Tet-On 3G transactivator under the c-Fos promoter Tet-On 3G rtTA Bong-Kiun Kaang 20342 ... N., Schambach, A., Galla, M., Maetzig, T., Baum, C., Loew, R., & Schiedlmeier, B. (2011). Retroviral ...expression of shRNA with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri... with puromycin selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection... -
CRISPR Pooled gRNA Libraries
TypeCollection...3rd 4 78,637 Broad GPP Humagne Set C and Humagne Set D 172650 (Set C) 172651 (Set D) Knockout Human Doench...Knockout Library 171531 Knockout Human Li 3rd ~6 9,274 MYC-CRISPR Library 173195 Knockout Human Dzikiewicz-Krawczyk...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...pneumoniae M. tuberculosis M. smegmatis Green monkey ( C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus...1000000074 (Puromycin) Activation Human Zhang 3rd 3 70,290 SAM v1 - 3 plasmid system 1000000075 (Puromycin) Activation...Library 159391 Knockout Mouse Moffat 3rd 4 182 Mycobacterium tuberculosis CRISPRi Library (RLC12) 163954 ...Inhibition M. tuberculosis Rock NA Varies 96,700 Mycobacterium smegmatis CRISPRi Library (RLC11) 163955 Inhibition... -
Bacterial Expression Systems
TypeCollection...peptides include: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr...reconstructed) BiFC Lynne Regan 168257 168472 pMRBad-C-wtBlc pET11a-N-DiB2 DiB2 (reconstructed) BiFC Jens...coli Cynthia Collins 112197 pANY3 Temperature (42 °C) Escherichia coli Yingfeng An Other Addgene Controlled...Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis Sabine...Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis Vinay...Acetamide Escherichia coli , Mycobacterium smegmatis Matthias Wilmanns 84692 pMyC-kan Acetamidase promoter... PnitA-NitR ε-caprolactam Escherichia coli , Streptomyces sp. Xuming Mao 46888 pMSP3545 PnisA Nisin Escherichia... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...: 95 °C for 15 min, 35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10...following parameters: 37 °C for 30 min; 95 °C for 5 min and then ramp down to 25 °C at 5 °C/min. Dilute oligos...parameters: Cycles 1-20 (37 °C for 5 min, 20 °C for 5 min); Cycle 21 (80 °C for 20 min). These cycling ...Incubate at 30 - 37 °C for 24 - 72 hr. 30 °C may enhance genome editing efficiency, but 37 °C is acceptable....cells to incubate at 37 °C for 3 - 7 days and allow the clones to incubate at 37 °C for 7 - 14 days. Vary...thermocycler and run the following program: 65 °C for 6 min, 98 °C for 2 min to extract gDNA. Measure the DNA...clones. Run sample in thermocycler: 65 °C for 6 min and 98 °C for 2 min to extract gDNA. Screen each clone... -
Validated gRNA Sequences
TypeCollection...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT... -
Viral Production
TypeCollection...80 °C. Titer All titering is performed on lentiviral preparations that have been stored at -80 °C and ...Preparations are then aliquoted and stored at -80 °C. Titer Titering is either performed by Addgene or ...Control Mycoplasma The 293T cell line was obtained from Takara, and is routinely tested for mycoplasma contamination... tested for mycoplasma contamination. To date, Addgene has never had a case of mycoplasma contamination...contamination using mycoplasma detection kits. The cell line is maintained for ~20 passages before being... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...pPD95_75 - C-terminal GFP for C. elegans expression pHT101-mCherry - N- or C-terminal mCherry for C. elegans...GFP and/or mCherry, with neomycin cassette Zebrafish, Sea urchin, Xenopus, and C. elegans Hamdoun Lab Plasmids...mNeonGreen 506 517 93 5.7 10 min Monomer pCS2+mNeonGreen-C Cloning Vector - Mammalian Expression Jump to Top ...pmScarlet_C1 - Mammalian Expression pCS2+mScarlet-C Cloning Vector - Mammalian Expression mScarlet-I 569...mCerulean Davidson Lab Plasmids - Includes many N- and C-terminal fluorescent proteins Insect Sutherland Lab...tagging with mCherry, mOrange, mCerulean pET GFP - C-terminal GFP for bacterial expression Davidson Lab... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein DR274 42250 C. elegans BsaI none S. pyogenes...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...pyogenes Zhang PX854 62886 Mammalian BbsI yes, cut, C-terminal S. pyogenes Zhang pGuide 64711 Mammalian ...pyogenes Zhang PX852 62884 Mammalian BbsI yes, cut, C-terminal S. pyogenes Zhang PX855 62887 Mammalian BbsI...pyogenes Zhang PX856 62888 Mammalian BbsI yes, activate, C-terminal S. pyogenes Zhang pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B...pyogenes URA3 Wyrick pCRISPomyces-2 61737 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pRB1017 59936...none S. pyogenes Zon pCRISPomyces-1 61736 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pMB70 47943 Worm... -
CRISPR Plasmids - Bacteria
TypeCollection...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...inducing a DNA break. Cytosine base editors convert C->T (or G->A on the opposite strand) within a small...which is replaced by guanosine to create A->G (or T->C on the opposite strand) mutations. ID Plasmid Promoter...NGG) 42875 pCRISPR BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9... -
CRISPR Plasmids - Plants
TypeCollection...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...inducing a DNA break. Cytosine base editors convert C->T (or G->A on the opposite strand) within a small...which is replaced by guanosine to create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene... As Cpf1 Qi 91715 pKEE401 yes, cut S. pyogenes Neomycin Chen Do you have suggestions for other plasmids... -
CRISPR Plasmids - Prime Edit
TypeCollection...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...which a reverse transcriptase (RT) is fused to the C terminus of Cas9 H840A nickase. The fusion enzyme ...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG... -
CRISPR History and Development for Genome Engineering
TypeCollection... Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and dicots) C. elegans Yeast (...Zebrafish Xenopus References Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero...23287718 Dalvai M, Loehr J, Jacquet K, Huard CC, Roques C, Herst P, Côté J, Doyon Y. 2015. A Scalable Genome-Editing-Based...Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann ... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection... a circular piece of DNA (and is not maintained). C) If the sites are on separate DNA molecules (in trans...proteins: The recombinase is split into inactive N- and C-terminal fragments and placed under the control of...integrase, derived from a Streptomyces phage, and Bxb1 integrase, from a mycobacteriophage, are serine SSRs that... inducible system (e.g., search for "split", "rapamycin", “tamoxifen”, or “light”): Cre Recombinase Plasmids... -
Botman-Teusink Yeast FP Collection
TypeCollection...PMID: 15197731 (Link opens in a new window) Vickers, C. E., Bydder, S. F., Zhou, Y., Nielsen, L. K. (2013...cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21 (8):661-70. https://doi.org...antibiotic selection markers for engineering in Saccharomyces cerevisiae. Microb Cell Fact, 12 :96. https:... -
mTOR Pathway
TypeCollection...PKC eta PKC iota PKC theta PKC zeta Protein kinase C Protor Also known as PRR5; proline rich 5 PTEN Phosphatase...Resources The m echanistic or m ammalian t arget o f r apamycin (mTOR) is a key metabolic regulator controlling...threonine kinase 11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1...associated protein 1 mTOR Mechanistic target of rapamycin p53 TP53; tumor protein p53 PDK1 Pyruvate dehydrogenase...10.1016/j.cell.2012.03.017. PubMed PMID: 22500797 . Rapamycin: one drug, many effects. Li J, Kim SG, Blenis ...