We narrowed to 4 results for: cmv promoter
-
TypeGuide...terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT...GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter Forward Luc-F AGTCAAGTAACAACCGCGA...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward T7 TAATACGACTCACTATAGGG...
-
Promoters
TypeGuide...Reference Promoters Promoters Prokaryotic Promoters Eukaryotic Promoters Resources A promoter is a region...a eukaryotic promoter: the core promoter, the proximal promoter, and the distal promoter (Figure 4). Figure...Eukaryotic Promoters Eukaryotic promoters are much more complex and diverse than prokaryotic promoters and span...bind. Distal Promoter The final portion of the promoter region is called the distal promoter, which is upstream...Strong promoter from baculovirus CAG Constitutive Mammalian Strong hybrid promoter; contains CMV early ...and the chicken beta-actin promoter CMV Constitutive Mammalian Strong promoter from human cytomegalovirus...elements, insulators, and silencers. Bacterial Promoters Promoters in bacteria contain two short DNA sequences... -
Lentiviral Vector Guide
TypeGuide...with a heterologous promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins... chimeric 5’ LTR fused to a heterologous promoter (often CMV or RSV), eliminating the need for transactivation...LTR for self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially deleted and fused... fused to a heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between... use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription...plasmids include tat , as the 5’ LTR is used as a promoter on the transfer plasmid, and this requires Tat...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope... -
Gamma-Retroviral Vector Guide
TypeGuide...heterologous promoter (usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript... use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription... to prefer transcription start sites, such as promoters and enhancers. Many times, integration sites are...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope...selection is driven by strong enhancers and active promoters. Nucleic Acids Research , 42 (7), 4257–4269. https...