We narrowed to 4 results for: pCas
- 
  TypeGuide...pyogenes (SP); SpCas9 3' NGG SpCas9 D1135E variant 3' NGG (reduced NAG binding) SpCas9 VRER variant 3'...NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, GAA, or GAT SpCas9-NG 3...engineered Cas9s can enhance CRISPR specificity. SpCas9 (from Streptococcus pyogenes ) is the most popular...no cuts. Cas9 nickase (Cas9n), a D10A mutant of SpCas9, has one active nuclease domain and one inactivated...fidelity enzymes, and their mechanisms, include: eSpCas9(1.1) — weaken interactions between the HNH/RuvC...RuvC groove and the non-target DNA strand SpCas9-HF1 — disrupt Cas9’s interactions with DNA phosphate backbone...your desired genes for modification. Engineered SpCas9 enzymes with altered PAM specificities are available...
- 
  Sequencing PrimersTypeGuide...Reverse pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT...GGGTTTTATTAACTTACAT 5' end of Drosophila mini-white gene Reverse pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter...
- 
  Modular Cloning GuideTypeGuide...with zCas9i, a high efficiency intron-optimized SpCas9-coding gene. MoClo CRISPR/Cas Toolkit for Plants...
- 
  Adeno-associated virus (AAV) GuideTypeGuide...Packaging the Cas9 from Streptococcus pyogenes (SpCas9) and a gRNA together into an rAAV capsid is challenging...