Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 3 results for: tet

Clear keywords
Showing: 1 - 3 of 3 results

  1. Sequencing Primers

    Type
    Guide
    ...' end of tdTomato Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R...origin Forward pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI site Forward pBRforEco ...Forward pBRrevBam GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI site Reverse pCAG-F GCAACGTGCTGGTTATTGTG...

  2. Promoters

    Type
    Guide
    ...as shRNAs and gRNAs. Additional Resources Tetracycline (Tet) Inducible Expression Plasmids 101: The Promoter...elongation factor promoter TRE Inducible Multiple Tetracycline response element promoter; often optimized for...

  3. Molecular Biology Reference

    Type
    Guide
    ...England Biolabs F' proA+B+ lacIq ∆(lacZ)M15 zzf::Tn10 (TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL *Carbenicillin can be used...
Showing: 1 - 3 of 3 results