We narrowed to 5 results for: tet
-
TypeGuide...' end of tdTomato Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R...origin Forward pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI site Forward pBRforEco ...Forward pBRrevBam GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI site Reverse pCAG-F GCAACGTGCTGGTTATTGTG...GAGTCACTTTAAAATTTGTATACAC ADH terminator Reverse pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward...
-
Promoters
TypeGuide...as shRNAs and gRNAs. Additional Resources Tetracycline (Tet) Inducible Expression Plasmids 101: The Promoter...elongation factor promoter TRE Inducible Multiple Tetracycline response element promoter; often optimized for... -
Molecular Biology Reference
TypeGuide...England Biolabs F' proA+B+ lacIq ∆(lacZ)M15 zzf::Tn10 (TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL *Carbenicillin can be used... -
CRISPR Guide
TypeGuide...— activation through increased H3K27 acetylation TET1 — activation through cytosine demethylation DNMT3A... a companion CRISPRon to undo repression using a TET1-dCas9 fusion. Figure 10: Overview of epigenetic ... -
Lentiviral Vector Guide
TypeGuide...LEDGF (also known as PSIP1 or p75 ), a lentiviral tethering gene that helps facilitate integration. Despite...