Skip to main content

We narrowed to 29 results for: tet

Showing: 1 - 20 of 29 results
  1. Tetracycline Inducible Expression

    Type
    Collection
    ... of tet-responsive systems: Tet-Off and Tet-On. Read on to learn more about the components of tet systems... center: Tet-Off; right: Tet-On. TRE: Tet response element; tTA: tetracycline-controlled transactivator... Plasmid Collections Tetracycline (Tet) Inducible Expression Tetracycline (Tet) Inducible Expression ...shown. Tetracycline Off (Tet-Off) The first major advance was the Tet-Off system. A tetracycline-controlled...conditions, the TetR protein binds to tet O, blocking transcription of the downstream gene. If tet or one of...highlighted Tet plasmids . Figure 1: Tet-regulated expression systems. Left: natural TetR mechanism; center...known as the tTA-dependent or tet-repressible system. Tetracycline On (Tet-On) In 1995, Gossen et al. used...
  2. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...-MCS-EGFP - Tet-inducible Find more Tet-inducible empty backbones on our Tetracycline (Tet) Inducible ...vector for mammalian genome editing Tet-pLKO-puro and Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression...Expresses ultraID in mammalian cells with the Tet-On or Tet-Off system Return to top Selectable Markers ...Backbones Neomycin (G418) Mammalian, Varies Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression Find...Pur - Eukaryotic expression vector Tet-pLKO-puro - Tet-inducible lentiviral shRNA expression...expression vector with N-terminal HA tag pInducer20 - Tet-inducible HA-tagged lentiviral vector for ORF expression...vector for gene expression pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral Gateway destination vector for...
  3. AAV Molecular Tools

    Type
    Collection
    ...tools/controls and tetracycline transactivators that can be used with tetracycline (tet)-inducible expression...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1... available from Addgene's viral service encoding tet-off transactivators and tools for affinity purification...pAAV-CAG-tTA CAG-driven, constitutive Expression of the tet-off transactivator (tTA) 2 Viviana Gradinaru 99120...Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator (tTA) with a positive feedback...promoter (ihSyn) Cre-dependent expression of the tet-off transactivator (tTA) with a positive feedback...Overexpression Tracers Tetracycline Transactivators and Inducible Tools These AAV encode tetracycline-inducible tools...
  4. Lentivirus Plasmids

    Type
    Collection
    ...selection. Christophe Benoist and Diane Mathis 21915 Tet-pLKO-puro 3rd Inducible expression of shRNA with ...EF-1a-driven GFP and shRNA under the control of a tet-responsive H1 promoter. Didier Trono 11651 pLVUT-...puromycin selection. Ie-Ming Shih 25737 pSLIK-Hygro 3rd Tet-based inducible shRNA or cDNA expression, gateway...additional variants. Iain Fraser 15948 pLOVE 3rd Tet inducible gateway destination plasmid for cDNA expression...additional variants. David Root 44012 pInducer20 3rd Tet-inducible lentivirus for ORF expression, multicistronic...plasmid 21374 for dTomato version. Bryan Welm 21916 Tet-pLKO-neo 3rd Inducible expression of shRNA with neomycin...additional variants. David Sabatini 171123 pLVX-TetOne-Puro-GFP 3rd Dox-inducible expression of GFP. Jason...
  5. Plasmid Collections

    Type
    Collection
    ...Microbiology Plant Expression Stem Cells Synthetic Biology Tet Inducible Expression Worm Expression Kits Kits are...
  6. Bikard Lab - CRISPR Repression Collection

    Type
    Collection
    ...strain expressing two reporters and dCas9 under a P-tet promoter integrated in the chromosome at phage attachment...allows for quick integration of the aTc-inducible pTet-dCas9 in the attachment site of the phage 186. Detailed...
  7. Mammalian RNAi Tools

    Type
    Collection
    ...that allow for conditional (Cre-lox) or inducible (Tet) expression are available. To find plasmids containing...
  8. E11 Bio PRISM Collection

    Type
    Collection
    ... has also developed a set of Cre-dependent, hSyn-Tet inducible plasmids (Addgene #242782–242799) suitable...
  9. Retrovirus Plasmids

    Type
    Collection
    ...IRES-mCherry. Dario Vignali 27995 TtRMPVIR CMV/MSV Tet-regulated expression of shRNA. Expresses rtTA. See...William Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in...
  10. Validated gRNA Sequences

    Type
    Collection
    ...24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim TET promoter...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere...
  11. Luciferase Plasmid Collection

    Type
    Collection
    ...Luciferase Firefly TRE Lentiviral vector with dox- or tet-inducible luciferase expression Stephen Tapscott ...expression of firefly luciferase William Kaelin 60495 pSBtet-GP Firefly TRE Dox-inducible expression of firefly...
  12. Bacterial Expression Systems

    Type
    Collection
    ...Controlled Expression Resources Check out our Tetracycline (Tet) Inducible Expression Collection for an extensive...Expression Species PI 44249 pdCas9-bacteria pTetO Anhydrotetracycline (aTc) Escherichia coli Stanley Qi 11518...coli Andreas Moeglich 68940 pRMC2 Pxyl/TetO Anhydrotetracycline (aTc) Staphylococcus aureus Tim Foster...glutamicum Timothy Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium...tuberculosis Sabine Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium...extorquens Christopher Marx 44448 pLC291 pR/TetO Anhydrotetracycline (aTc) Methylobacterium extorquens Christopher...baumannii Jason Peters 127088 pMS17 tcp830 Anhydrotetracycline (aTc) Streptomyces sp. Maggie Smith 74065...
  13. Brain Initiative Collection

    Type
    Collection
    ...Gradinaru 117383-AAV1 TRE-DIO-eYFP An AAV genome with tet-inducible, Cre-dependent expression of the fluorescent...
  14. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... Wheeldon FgH1tUTG 70183 Mammalian/Lentiviral H1-Tet none S. pyogenes Herold lentiGuide-Crimson 70683 ...Zhang pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA 73796 Yeast pRPR1(TetO) yes, interfere S. pyogenes...yes, nick S. pyogenes Duchek pAC5-dual-dCas9VP48-sgTetO 48237 Mammalian BbsI yes, activate S. pyogenes ...Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes Elverlov-Jakobsen...62315 Yeast none S. pyogenes URA3 Lim, Qi pRPR1(1xTetO)_gRNA_handle_RPR1t 62966 Yeast HindIII none S. ...pyogenes EGFP Zou pRS416gT-GalL-Cas9 79903 Yeast RPR1(TetO) yes, cut S. pyogenes URA3 Davis eSpCas9(1.1) 71814...
  15. Genetic Code Expansion

    Type
    Collection
    ...Ryan Mehl 85496 pDule-Tet2.0 Tetrazine2.0 tRNA synthetase M. jannaschii Tetrazine 2.0 Bacterial TAG Ryan...Ryan Mehl 85497 pDule2-Tet2.0 Tetrazine2.0 tRNA synthetas M. jannaschii Tetrazine 2.0 Bacterial TAG Ryan...Bacterial TAG Ryan Mehl 164580 pUltraI-Tet3.0[TAA] Tet3.0RS M. barkeri Tet3.0 Bacterial TAA Ryan Mehl 172482 ...TAG Ryan Mehl 174080 pDule-Tet3.0 Tet3.0 tRNA synthetase M. barkeri Tetrazine 3.0 Bacterial TAG Ryan Mehl...NES-Flag-R2-84-MbRS Tetrazine3.0 NES-Flag-R2-84 tRNA synthetase M. barkeri Tetrazine 3.0 Mammalian Ryan...aminoacyl-tRNA synthetase M. jannaschii 1,2,4,5-tetrazine ncAAs Bacterial TAG Ryan Mehl 217361 pIDTSmart-MbPylRS...
  16. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...eqFP611 559 611 35 Tetramer eqFP611-N1 - Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian...CYPet-C1 - Mammalian Expression AmCyan1 453 486 11 Tetramer AmCyan1-N1 - Mammalian Expression mTFP1 462 492...Expression (cysteine-free SGFP2) ZsGreen 493 505 39 Tetramer pHIV-Zsgreen - Mammalian Expression (this is a...YPet-pBAD - Bacterial Expression ZsYellow1 529 539 8 Tetramer ZsYellow1-N1 - Mammalian Expression mPapaya1 530...- Bacterial Expression DsRed 558 583 49 > 24 h Tetramer mDsRed-C1 - Mammalian Expression mDsRed-N1 - Mammalian...Mammalian Expression E2-Crimson 611 646 29 4.5 24 min Tetramer pAAV-CAG-E2-Crimson - Mammalian AAV Expression...Expression Kaede 508 572 518 580 380 87 20 5.6 5.6 Tetramer Kaede-N1 - Mammalian Expression Kaede-C2 - Mammalian...
  17. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...sensors, ER-targeted CEPIA1er ER-mitochondria tethering by PDZD8 regulates Ca(2+) dynamics in mammalian...Yulong Li ADP Biosensor for ADP based on tetramethylrhodamine-labeled ParM A fluorescent, reagentless ...reagentless biosensor for ADP based on tetramethylrhodamine-labeled ParM. ACS Chem Biol. 2010 Apr 16;5(4):415-25...single cells. Angew Chem Int Ed Engl. 2018 Jun 27. Tetsuya Kitaguchi ATP Variants of ATP sensor iATPSnFR1.0...dual-color imaging. PLoS One. 2014 Jun 24;9(6):e100252. Tetsuya Kitaguchi cAMP (cyclic AMP) Red fluorescent protein-based...in vivo imaging. Sci Rep. 2017 Aug 4;7(1):7351. Tetsuya Kitaguchi cAMP (cyclic AMP) Fluorescent sensor ...and PDE5alpha. ACS Sens. 2017 Jan 27;2(1):46-51. Tetsuya Kitaguchi cGMP (cyclic GMP) FlincG3 (GFP-based ...
  18. Zhang Lab CRISPR Page

    Type
    Collection
    ...sgRNA incorporating two MS2 RNA aptamers at the tetraloop and stemloop 2 The MS2-P65-HSF1 activation helper...61424 : sgRNA cloning backbone with MS2 loops at tetraloop and stemloop - Contains BbsI sites for insertion...lentiviral sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker....
  19. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...188572 Tet-off TauRD (P301L/V337M) MAPT Myc TRE Parkinson's, FTD Franz-Ulrich Hartl 188573 Tet-off Full...Ataxia Richard Youle 176485 Piggybac-TetO-hNurr1-blast NR4A2 TetO Parkinson's Marius Wernig 176852 UBQLN2...Ronald Hart 190811 pTet-O-APOE-E2-T2A-Puro APOE UbC Alzheimer's Ronald Hart 190812 pTet-O-APOE-E3-T2A-Puro...Flag, GFP CMV ALS Tanja Mittag 234848 pLV.tetO.Nurr1 NR4A2 TetON Parkinson's Malin Parmar 234872 PGK-HA-PGRN... CMV Ataxia telangiectasia Stephen Elledge 43918 tetO-ALN NR4A2 His, V5 TRE Parkinson's John Gearhart ...T2A-Puro APOE UbC Alzheimer's Ronald Hart 190813 pTet-O-APOE-E4-T2A-Puro APOE UbC Alzheimer's Ronald Hart ...Lukas Trantirek 232478 pB-TR-hSOD1 SOD1 Flag CMV-TetO ALS Lukas Trantirek 232481 pHLsec hSOD1 SOD1 Flag...
Showing: 1 - 20 of 29 results