We narrowed to 3 results for: tetracycline
-
TypeGuide...elongation factor promoter TRE Inducible Multiple Tetracycline response element promoter; often optimized for...such as shRNAs and gRNAs. Additional Resources Tetracycline (Tet) Inducible Expression Plasmids 101: The...
-
Sequencing Primers
TypeGuide...Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA... -
Molecular Biology Reference
TypeGuide.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL *Carbenicillin can be used...