...' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - ...To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo...AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT...AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3' Note: If you plan to...CAGCT - 5' Note: We could leave off the 3’ G on each oligo (and the complementary C of the other oligo),...tube. Place tube in 90-95°C hot block and leave for 3-5 minutes. Remove the hot block from the heat source...vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate ...

...selection of pLKO.1 plasmid in mammalian cells. sin 3’LTR 3’ Self-inactivating long terminal repeat. f1 ori...antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—21bp sense—CTCGAG—21bp antisense 3’ For example...Vector A.1 The RNAi Consortium A.2 Map of pLKO.1 A.3 Related plasmids B. Designing shRNA Oligos for pLKO... C.1 Recommended materials C.2 Annealing oligos C.3 Digesting pLKO.1 TRC-Cloning Vector C.4 Ligating and...Determining the optimal puromycin concentration F.3 Protocol for lentiviral infection and selection G....Sequence of pLKO.1 TRC-Cloning Vector I.2 Recipes I.3 Warranty information Back to Top A. pLKO.1-TRC Cloning...long terminal repeat. RRE Rev response element. A.3 Related Products The following plasmids available ...

...strand completely; it is essential, however, that the 3’ end of the primer corresponds completely to the template...proceed. Usually a guanine or cytosine is used at the 3’ end, and the 5’ end of the primer usually has stretches...stretches of several nucleotides. Also, both of the 3’ ends of the hybridized primers must point toward ...restriction site at the 5’ end of your primer, note that a 3-6 base pair "clamp" should be added upstream in order...amplification process. When designing, if unsure about what nucleotide to put at a certain position within...capabilities. Taking into consideration the information above, primers should generally have the following properties...

...assist with restriction enzyme digestion (usually 3-6bp). Restriction Site: Your chosen restriction site...Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and we will add...our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut DNA efficiently...more information). Thus, we recommend that you add 3-6 bases upstream of your restriction site to improve... sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design is similar, but...including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then TAAGCA to ...sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to the ORF). We now ...

... 20, 2022 Workflow Timeline Day 1: Seed cells Day 3-4: Fix and label cells Equipment Pipette controller...a 24-well cell culture treated plate. Seed 5 x 10 3 HeLa cells per well. Allow the HeLa cells to grow ... min in 500 µL PBS on a rocking platform. Section 3: Labeling with antibody Block for 20 min at RT on ...water Microscope slide Anti-fade mounting medium Laboratory wipes 15 mL conical tubes 50 mL conical tubes...paraformaldehyde and follow your institution's laboratory safety guidelines for disposing of waste in the...remove the coverslip. Blot the coverslip with a laboratory wipe to remove excess liquid. Add 1 drop of anti-fade...

...0: Seed cells in CS2 Day 2: Seed cells in CS5 Day 3 (am): Transfect cells Day 7 (am): Harvest cells Equipment...interest Triton X-100 Benzonase/DNAse I (Millipore 71205-3) 40% Polyethylene Glycol 8000 (PEG) + 0.5 M NaCl Cell... PBS and add 35 mL of 0.05% Trypsin/EDTA. Wait ~2-3 minutes for cells to detach. Gently tap the sides ...stir slowly at 4 °C for 1 h, then keep at 4 °C for 3 h without stirring to allow full precipitation. Precipitation... at 4 °C if needed. Transfer the entire sample to 3 x 500 mL conical bottles and centrifuge at 3900 rpm....8-fold. See the recipe for D1 + 0.1 M sorbitol above. Carefully pour off the media into a waste container...in a total of 5 mL of cell lysis buffer (recipe above). Pipet back and forth to resuspend each pellet ...

... 1 µg DNA 1 µL of each Restriction Enzyme 3 µL 10x Buffer 3 µL 10x BSA (if recommended) x µL dH 2 O (to... T4 DNA Polymerase or Klenow DNA Polymerase I for 3′ overhang removal and 5′ overhang fill-in. If you ...more at (Link opens in a new window) NEB's website about star activity . If you are digesting a large number...

...end that is identical to an adjacent segment and a 3′ end that anneals to the target sequence. One strategy...reaction: T5 Exonuclease - creates single-strand DNA 3’ overhangs by chewing back from the DNA 5’ end. Complementary...) to the isothermal reaction mix. ET SSB protects 3’ ssDNA ends from the ssDNA-specific endonuclease activity... the right). When designing your plasmid, think about what DNA segments you will need to join to create...

...Cells Day 2–3 (am): Remove media, replace with fresh media containing selection reagent Day 3–14: Change...300 200 1:10 150 350 1:50 30 470 1:100 15 485 1:500 3 497 Add 0.5 mL of a single viral dilution to each ...cell death, the cell media should be changed every 2–3 days to maintain the dose of antibiotic, which may...cells in the untransduced well (0 µL lentivirus, above) are dying. Perform regular media changes and monitor...

...recover, set up overnight growth (Estimated time 2-3 hours) Transformation should be performed at the end...Day 2: Harvest cells and purify DNA (Estimated time 3-4 hours) Cells should be harvested first thing in ...µL micropipette tips in a -20 °C freezer. Aliquot 3 mL SOC into each of four 14 mL Vented Falcon Tubes...cuvette and add to 14 mL vented Falcon Tube containing 3 mL SOC. Repeat for each of the 25 µl aliquots of cell...Vented Falcon Tubes should contain a total of 5 mL (3 mL SOC + 2 mL transformed Endura from two separate...require modifications dictated by the originating laboratory for optimal results. If you obtained the pooled...

...plasmid fingerprinting", where you cut the plasmid into 3-8 pieces such that all (or most) fragments are small...insert, but significantly off center (ideally around 1/3 of the way from one end), and also cuts in the backbone...verification, such as DNA sequencing . In the example above, digestion with enzyme RE1 will linearize the 6200bp...that you get double confirmation. In the example above, digestion with either RE3 or RE4 will give a very...

...anneal to the regions upstream (5’) and downstream (3’) of the DNA segment to be amplified. When these reagents... increase the time of the denaturing. Your 5’ and 3’ primers should be designed to have similar melting...Reverse Primers: Hybridize and are complementary to the 3’ ends of the sense and anti-sense strands of the template...manufacturer’s instructions for specific instructions about extension time and temperatures. Initial Denaturation...

...concentration of approximately 0.2-0.5 μg/mL (usually about 2-3 μl of lab stock solution per 100 mL gel). EtBr...different buffers and do not use water). Microwave for 1-3 min until the agarose is completely dissolved (but...cool down to about 50 °C (about when you can comfortably keep your hand on the flask), about 5 mins. Optional... of the tip of the pipette into the buffer just above the well. Very slowly and steadily, push the sample... of the way down the gel. A typical run time is about 1-1.5 hours, depending on the gel concentration ...

...recipient plasmid to insert ratio of approximately 1:3. Since the number of base pairs for each varies, it...colonies and check them for successful ligations. Pick 3-10 colonies depending on the number of background ...Information about plasmid cloning by restriction enzyme digest (subcloning), including design and experimental...window) New England Biolabs for more information about restriction enzyme buffers). If you select enzymes...

...VWR, EX0276-1 Benzonase 250 U/µl, Millipore #71205-3 Polybrene 10 mg/mL, Millipore, TR-1003-G Molecular...mL glutaGRO 50 U/mL benzonase: 15 mL DMEM Complete 3 µL of 250 U/µL benzonase Procedure Transducing Cells...0.03887375114 6.22E+06 2 400 768 18360 0.08366013072 6.69E+06 3 200 1620 15840 0.2045454545 8.18E+06 4 100 3180 20540...the titer. Calculations In the experimental setup above, the following virus dilutions were used to transduce...v = Virus volume, mL *In the experimental setup above, the cells per well is 300,000 and the virus volume...

... or isopropanol 90% ethanol 70% ethanol TE buffer 3 M Na-acetate (pH 4.8) Protocol: Generalized DNA Purification....5 volumes 95% or 100% ethanol and 1/10 volume of 3 M Na-acetate (pH 4.8). Invert the microfuge tube to... supernatant out of the tube if you are worried about losing the pellet. Dry with vacuum or by inverting...

... the last section of the plate, to create streak #3. Incubate plate with newly plated bacteria overnight...resistance and your initials. Labeling within a laboratory setting is important for organization, and it...a section of the plate, as shown in the diagram above, to create streak #1. Pro-Tips Hold your tooth pick...

...Addgene's plasmid information pages recommend 5’ and 3’ sequencing primers. These primers typically anneal...Addgene lists the primers used to obtain each result above the posted sequence in the "View Sequence" link....sequence than expected and wish to contact Addgene about the accuracy of your plasmid, please email help@...

...if you are using disinfectants as described above in step 3. You will also need to maintain the appropriate... lab! Introduction A water bath is a piece of laboratory equipment that helps bring your materials to ...

...Timeline Day 1: Antigen Coating Day 2: Blocking Day 3: Primary antibody incubation Day 4: Secondary antibody...at room temperature or overnight at 4 °C . Section 3: Primary antibody incubation Carefully remove the ...point. If your unknown sample’s absorbance falls above the range of the standard curve you will need to...