We narrowed to 20 results for: HA tag
-
TypeProtocol... a Multiple Cloning Site (MCS) Adding short tags - ex: HA or Flag Cloning shRNAs Background For the purposes...technique can be used just as easily to add short tags or shRNAs to any vector (the procedure will simply... design). Let's assume that your favorite vector has a relatively limited MCS (BamHI - EcoRI - SalI) and...
-
Protocol - How to Perform Sequence Analysis
TypeProtocol... Pages. Addgene sequences the plasmid to verify tags, mutations and a portion of the insert, but we do...provided by your sequencing provider. My sequence has “N”s in it- what does that mean? “N” is the letter... -
Protocol - How to Run an Agarose Gel
TypeProtocol...you to gauge how far the DNA has migrated; 2) it contains a high percentage of glycerol that increases ...continue towards a boil. Keep an eye on it the solution has a tendancy to boil over. Placing saran wrap over ...sit at room temperature for 20-30 mins, until it has completely solidified. Pro-Tip If you are in a hurry...with water to even out the staining after the gel has been run, just as you would if you had not added ...water and destain for 5 mins. Using any device that has UV light, visualize your DNA fragments. The fragments...adjust the agarose percentage of the gel to get better separation. A higher percentage agarose gel will ...electrophoresis. Equipment Casting tray Well combs Voltage source Gel box UV light source Microwave Reagents... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...clones with pLKO.1 sequencing primer (5’ CAA GGC TGT TAG AGA GAT AAT TGG A 3’). TIP: You may need to adjust...vector is the backbone upon which The RNAi Consortium has built a library of shRNAs directed against 15,000...shRNA insert. The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with... the sequencing conditions if the DNA polymerase has difficulty reading through the secondary structure... in contact with the walls of the tube before it has been diluted. Mix by swirling or gently flicking ... 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’...AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO... -
Isolating a Monoclonal Cell Population by Limiting Dilution
TypeProtocol...starting this procedure, be sure that the cell pool has been sufficiently selected with the appropriate antibiotic... antibiotic so that every cell in the culture has, in theory, been transduced. There are various schools...regularly for transgene expression. This protocol has been optimized for adherent cells but can be modified...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Heat-inactivated FBS 1X PBS...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ...55 mL of heat-inactivated FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Polyclonal stable cell pool: see... -
AAV Production in HEK293 Cells
TypeProtocol...clogging during harvesting. The addition of sorbitol has been shown to increase viral titers by up to 1.8-...10 min and then recheck the pH to ensure that it has not drifted. Filter the solution through a 0.22 μm...such as sorbitol and sodium bicarbonate, sorbitol has been found to increase viral titers by up to 1.8-...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Opti-MEM, Thermo Fisher 31985...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ...add 55 mL of heat-inactivated FBS and 5 mL of glutaGRO 11 mL of 200 mM L-alanyl-L-glutamine. Store at 4 ....46 M sorbitol, 7.5 mL HI-FBS, and 7.5 mL 100X glutaGRO, 7.5 mL of 7.5% Sodium Bicarbonate, 7.5 mL 1 M... -
Transfection for Recombinant Antibodies
TypeProtocol...final volume of 1 L and recheck pH to ensure that it has not drifted. Filter the solution through a 0.22 µm...incubate for 1 h at room temperature. After the BCD TFX has warmed in the bead bath, transfer the tubes to the...-188 10% Pluronic F-18, Thermo Fisher 24040032 Glutagro, Corning 25-015-CI BalanCD HEK293 Media, Irvine...HEK293 Media 10 mL 10% Pluronic-F68 40 mL 200 mM Glutagro Do not add selective reagents Store at 4 °C until...BCD Feed 500 mL BalanCD HEK293 Feed 20 mL 200 mM Glutagro Store at 4 °C until use. We suggest preparing ... -
Virus Protocol - Generating Stable Cell Lines
TypeProtocol...polyclonal cell population, meaning that the transgene has integrated in different locations in the various ...variety of dilutions and pick the population that has the most desirable level of expression. Over time...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Heat-inactivated FBS Polybrene...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ... 55 mL of heat-inactivated FBS and 5mL of 100X glutaGRO. Store at 4 °C. Pro-Tip Different brands and FBS... -
DNA Quantification
TypeProtocol... it is possible that the difference between them has affected the accuracy of the NanoDrop. It is a good...Background Information During several different stages of molecular cloning, it is important to get a ... -
What is Polymerase Chain Reaction (PCR)
TypeProtocol...Extend DNA for 1 minute at 72°C: The Taq polymerase has an optimal temperature around 70-75°C so this step...changes during a typical PCR. The DNA polymerase has an optimum temperature around 70°C and is the molecule...cations can also be used for PCR-mediated DNA mutagenesis. A higher cation concentration increases the ... -
Using a Light Microscope Protocol
TypeProtocol...objective performs essentially the same task but has different magnifying powers. When you look at the...microscope stage. If using a slide, you can secure it into place using the metal clips on the stage. Turn ...Turn on the power source and use the stage arm to move the stage so that the light shines onto your sample...Once your sample is in focus, use the stage arm to move the stage (and ultimately your slide) until your... As the name suggests, light microscopes take advantage of the physical properties of light to detect ....com. Base Light Source Condenser and Diaphragm Stage Objective Lenses Focus Knobs (Fine and Coarse) Nosepiece...Slides (or other sample that can fit on a microscope stage) Reagents None needed Procedure Set up your microscope... -
General Transfection
TypeProtocol...10 min and then recheck the pH to ensure that it has not drifted. Filter the solution through a 0.22 µm...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Heat-inactivated FBS Low serum...L-alanyl-L-glutamine (or stable alternative such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ...55 mL of heat-inactivated FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Pro-Tip Different brands and lots...transfection to determine what ratio gives the highest percentage of GFP positive cells. Refer to the table below... -
Protocol - How to Perform a Diagnostic Digest
TypeProtocol...restriction enzyme, you will need to verify that it has be cloned in the correct orientation - this can be... A diagnostic restriction enzyme digest takes advantage of the fact that restriction enzymes cleave DNA... -
Lentivirus Production
TypeProtocol...10 min and then recheck the pH to ensure that it has not drifted. Filter the solution through a 0.22 μm...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Low serum medium such as Opti-MEM...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ...add 55 mL of heat-inactivated FBS and 5 mL of glutaGRO. Store at 4 °C. Pro-Tip Different brands and lots...transfection to determine what ratio gives the highest percentage of GFP positive cells. Refer to the table below... -
Colony Formation Titering Assay
TypeProtocol...mL) x dilution factor e.g., If the 1:100,000 well has 75 colonies, then there are 75 colonies /1.5 mL x...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Heat-inactivated FBS Polybrene...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ...55 mL of heat inactivated FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Pro-Tip Different brands and lots... -
Handling Plasmids from Addgene - Purifying Plasmid DNA
TypeProtocol...buffer such as TE. You will now have plasmid DNA that has been purified away from the bacterial proteins and...DNA are denatured. Pro-Tip Do not vortex at this stage or the genomic DNA will become sheared and will ... -
Plasmid Cloning by PCR (with Protocols)
TypeProtocol...restriction enzyme based cloning. DNA replication by PCR has error rates that range from roughly 1 per 500bp to...final Reverse Primer sequence of 5’-TGCTTAGCGGCCGCTCAGTACTTCGAGATATGCCA-3’. Experimental Procedure Run PCR... -
Lentivirus ddPCR Titration
TypeProtocol...sealer and press the ‘Seal’ button. After the plate has been sealed, proceed to thermocycling. Thermal Cycling...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) 1X PBS pH 7.4 without calcium...Primers/probe targeting RRE: forward primer: tgtgccttggaatgctagt probe (FAM): tttggaatcacacgacct reverse primer...inactivated premium grade, fetal bovine serum 5 mL glutaGRO 50 U/mL benzonase: 15 mL DMEM Complete 3 µL of... -
CRISPR Library Amplification
TypeProtocol... evenly with a sterile spreader until all liquid has been absorbed by the agar. This usually takes 1-2...Caution Electroporation involves the use of high voltages, please use caution when activating pulse and ...down at 30 ℃ overnight. Critical Ensure at this stage that no unabsorbed media drips onto the lid. Let... -
AAV ddPCR Titration
TypeProtocol...sealer and press the ‘Seal’ button. After the plate has been sealed, proceed to thermocycling. Thermal Cycling...CGGCCTCAGTGAGCGA ITR Reverse Primer: 5’-GGAACCCCTAGTGATGGAGTT ITR Probe: -FAM-CACTCCCTCTCTGCGCGCTCG-BBQ...