Skip to main content

pSLQ1651-sgRNA(F+E)-sgGal4
(Plasmid #100549)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100549 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSLQ1651-sgRNA(F+E)
  • Backbone manufacturer
    Addgene #51024
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin ; mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgGal4
  • gRNA/shRNA sequence
    GAACGACTAGTTAGGCGTGTA
  • Species
    E. coli
  • Insert Size (bp)
    963
  • Promoter U6
  • Tag / Fusion Protein
    • sgRNA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GAGATCCAGTTTGGTTAGTACCGGG
  • 3′ sequencing primer ATGCATGGCGGTAATACGGTTAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ1651-sgRNA(F+E)-sgGal4 was a gift from Jian Xu (Addgene plasmid # 100549 ; http://n2t.net/addgene:100549 ; RRID:Addgene_100549)
  • For your References section:

    In Situ Capture of Chromatin Interactions by Biotinylated dCas9. Liu X, Zhang Y, Chen Y, Li M, Zhou F, Li K, Cao H, Ni M, Liu Y, Gu Z, Dickerson KE, Xie S, Hon GC, Xuan Z, Zhang MQ, Shao Z, Xu J. Cell. 2017 Aug 24;170(5):1028-1043.e19. doi: 10.1016/j.cell.2017.08.003. 10.1016/j.cell.2017.08.003 PubMed 28841410