-
PurposesgGal4-expressing vector modified from Addgene plasmid #51024
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100549 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSLQ1651-sgRNA(F+E)
-
Backbone manufacturerAddgene #51024
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin ; mCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgGal4
-
gRNA/shRNA sequenceGAACGACTAGTTAGGCGTGTA
-
SpeciesE. coli
-
Insert Size (bp)963
- Promoter U6
-
Tag
/ Fusion Protein
- sgRNA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GAGATCCAGTTTGGTTAGTACCGGG
- 3′ sequencing primer ATGCATGGCGGTAATACGGTTAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ1651-sgRNA(F+E)-sgGal4 was a gift from Jian Xu (Addgene plasmid # 100549 ; http://n2t.net/addgene:100549 ; RRID:Addgene_100549) -
For your References section:
In Situ Capture of Chromatin Interactions by Biotinylated dCas9. Liu X, Zhang Y, Chen Y, Li M, Zhou F, Li K, Cao H, Ni M, Liu Y, Gu Z, Dickerson KE, Xie S, Hon GC, Xuan Z, Zhang MQ, Shao Z, Xu J. Cell. 2017 Aug 24;170(5):1028-1043.e19. doi: 10.1016/j.cell.2017.08.003. 10.1016/j.cell.2017.08.003 PubMed 28841410