pTKEI-tLOV
(Plasmid
#100574)
-
PurposeExpression plasmid for the thermostable anaerobic fluorescent protein tLOV
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100574 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTKEI-Dest
- Backbone size w/o insert (bp) 3712
- Total vector size (bp) 4042
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametLOV
-
SpeciesSynthetic
-
Insert Size (bp)330
- Promoter pTrc
-
Tag
/ Fusion Protein
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer AATGTGTGGAATTGTGAGCG
- 3′ sequencing primer CAGACCGCTTCTGCGTTCTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTKEI-tLOV was a gift from David Savage (Addgene plasmid # 100574 ; http://n2t.net/addgene:100574 ; RRID:Addgene_100574) -
For your References section:
Rapid and Programmable Protein Mutagenesis Using Plasmid Recombineering. Higgins SA, Ouonkap SVY, Savage DF. ACS Synth Biol. 2017 Jul 24. doi: 10.1021/acssynbio.7b00112. 10.1021/acssynbio.7b00112 PubMed 28707884