pDRF'- AmTryoshka1;3-LS-L255I
(Plasmid
#100964)
-
PurposeYeast expression of fluorescent sensor reporting the activity of ammonium transceptors. Contains a stable reference LSSmOrange nested within the reporting superfolder cpEGFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100964 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDRf1
- Backbone size w/o insert (bp) 6939
- Total vector size (bp) 9869
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAmTryoshka1;3-LS-L255I
-
Alt nameAmTryoshka-LS-FN-L255I
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)2935
-
MutationL255I
-
Entrez GeneAMT1;3 (a.k.a. AT3G24300, AMMONIUM TRANSPORTER 1;3, ATAMT1;3, ammonium transporter 1;3)
- Promoter PMA
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AACAATCGTTAATAATTAATTAATTGG
- 3′ sequencing primer GAAGTGTCAACAACGTATCTACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDRF'- AmTryoshka1;3-LS-L255I was a gift from Wolf Frommer (Addgene plasmid # 100964 ; http://n2t.net/addgene:100964 ; RRID:Addgene_100964) -
For your References section:
Ratiometric Matryoshka biosensors from a nested cassette of green- and orange-emitting fluorescent proteins. Ast C, Foret J, Oltrogge LM, De Michele R, Kleist TJ, Ho CH, Frommer WB. Nat Commun. 2017 Sep 5;8(1):431. doi: 10.1038/s41467-017-00400-2. 10.1038/s41467-017-00400-2 [pii] PubMed 28874729