Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

p6XHis_NLS-SaCas9
(Plasmid #101086)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 101086 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use strain Rosetta 2(DE3) for expression.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRISPR-associated protein Cas9/Csn1 [Staphylococcus aureus subsp. aureus]
  • Alt name
    SaCas9
  • Species
    Staphylococcus aureus
  • Insert Size (bp)
    3192
  • GenBank ID
    CCK74173.1
  • Promoter T7lac
  • Tag / Fusion Protein
    • TrxA-6xHis-STag (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Entrez Gene ID
CCK74173.1

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p6XHis_NLS-SaCas9 was a gift from Rick Tarleton (Addgene plasmid # 101086 ; http://n2t.net/addgene:101086 ; RRID:Addgene_101086)
  • For your References section:

    Rapid, Selection-Free, High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins. Soares Medeiros LC, South L, Peng D, Bustamante JM, Wang W, Bunkofske M, Perumal N, Sanchez-Valdez F, Tarleton RL. MBio. 2017 Nov 7;8(6). pii: e01788-17. doi: 10.1128/mBio.01788-17. 10.1128/mBio.01788-17 PubMed 29114029