pCLIPf-NK1R Control Plasmid
(Plasmid
#101125)
-
PurposeExpression of CLIP-tagged Neurokinin-1 Receptor in Mammalian cells
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101125 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCLIP
- Backbone size w/o insert (bp) 5235
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418) ; Kanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNeurokinin-1 Receptor, Truncated
-
Alt nameNK1R
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1179
-
Entrez GeneTACR1 (a.k.a. NK1R, NKIR, SPR, TAC1R)
- Promoter CMV
-
Tags
/ Fusion Proteins
- 10xHis (C terminal on backbone)
- CLIP-tag (CLIPf) (N terminal on backbone)
- FLAG Epitope (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer ATCCCCTGCCACCGGGTGGT (SNAP/CLIP Forward Primer)
- 3′ sequencing primer CTGGGGCAGGCACTTCCA (SNAP/CLIP Reverse Primer) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Originally cloned by Covalys. The truncated NK1R is an N-terminal insert. The Flag Epitope is a C-insert. The vector is also resistant to Kanamycin.
For more information on this plasmid, please see https://www.addgene.org/depositor-collections/neb-cell-imaging-tags/
This plasmid is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). For more information about commercial rights, please contact NEB's Global Business Development team at [email protected].
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCLIPf-NK1R Control Plasmid was a gift from New England Biolabs & Ana Egana (Addgene plasmid # 101125 ; http://n2t.net/addgene:101125 ; RRID:Addgene_101125)