Skip to main content
Addgene

pCLIPf-NK1R Control Plasmid
(Plasmid #101125)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 101125 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pCLIP
  • Backbone size w/o insert (bp) 5235
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418) ; Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Neurokinin-1 Receptor, Truncated
  • Alt name
    NK1R
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1179
  • Entrez Gene
    TACR1 (a.k.a. NK1R, NKIR, SPR, TAC1R)
  • Promoter CMV
  • Tags / Fusion Proteins
    • 10xHis (C terminal on backbone)
    • CLIP-tag (CLIPf) (N terminal on backbone)
    • FLAG Epitope (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer ATCCCCTGCCACCGGGTGGT (SNAP/CLIP Forward Primer)
  • 3′ sequencing primer CTGGGGCAGGCACTTCCA (SNAP/CLIP Reverse Primer)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Originally cloned by Covalys. The truncated NK1R is an N-terminal insert. The Flag Epitope is a C-insert. The vector is also resistant to Kanamycin.

For more information on this plasmid, please see https://www.addgene.org/depositor-collections/neb-cell-imaging-tags/

This plasmid is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). For more information about commercial rights, please contact NEB's Global Business Development team at [email protected].

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCLIPf-NK1R Control Plasmid was a gift from New England Biolabs & Ana Egana (Addgene plasmid # 101125 ; http://n2t.net/addgene:101125 ; RRID:Addgene_101125)