Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pACP-ADRβ2 Control Plasmid
(Plasmid #101128)


Item Catalog # Description Quantity Price (USD)
Plasmid 101128 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6824
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418) ; Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Beta-2-Adrenergic Receptor
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    ADRB2 (a.k.a. ADRB2R, ADRBR, B2AR, BAR, BETA2AR)
  • Promoter CMV
  • Tag / Fusion Protein
    • ACP-tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SbfI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer GACGCAAATGGGCGGTAG (CMV Forward Primer)
  • 3′ sequencing primer AGGGAGTACTCACCCCAACA (ST1 Reverse Primer)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Originally cloned by Covalys. The ACP-tag is an N-vector tag. Additional antibiotic resistance to Kanmycin

For more information on this plasmid, please see

This plasmid is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). For more information about commercial rights, please contact NEB's Global Business Development team at [email protected].

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACP-ADRβ2 Control Plasmid was a gift from New England Biolabs & Ana Egana (Addgene plasmid # 101128 ; ; RRID:Addgene_101128)