sg2.0 (PP7) Locus#2
(Plasmid
#101155)
-
PurposegRNA with two PCP binding sites
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti
- Total vector size (bp) 10000
-
Vector typeLentiviral, CRISPR
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLocus #2(tandem repeat)
-
gRNA/shRNA sequenceGAGAGTTGAGTCTGTACTGT
-
SpeciesH. sapiens (human)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GAG GGC CTA TTT CCC ATG ATT CCT TCA TAT
- 3′ sequencing primer cctagaaggtccattagctgcaaagattcc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sg2.0 (PP7) Locus#2 was a gift from Mazhar Adli (Addgene plasmid # 101155 ; http://n2t.net/addgene:101155 ; RRID:Addgene_101155) -
For your References section:
Live cell imaging of low- and non-repetitive chromosome loci using CRISPR-Cas9. Qin P, Parlak M, Kuscu C, Bandaria J, Mir M, Szlachta K, Singh R, Darzacq X, Yildiz A, Adli M. Nat Commun. 2017 Mar 14;8:14725. doi: 10.1038/ncomms14725. 10.1038/ncomms14725 PubMed 28290446