-
PurposeGenetically encoded voltage indicator (GEVI) ASAP2s in AAV vector for neuron-specific expression using the promoter hSyn1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101276 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4562
- Total vector size (bp) 6656
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameASAP2s
-
SpeciesSynthetic
-
Insert Size (bp)1281
-
GenBank IDMF682491
- Promoter hSyn (human synapsin)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AGGGTCAGTTTGCCAATGGT
- 3′ sequencing primer CCGGTGCTGCTGCCGGATAA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The next-generation JEDI-2P sensors are available at: https://www.addgene.org/browse/article/28223314/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-ASAP2s was a gift from Francois St-Pierre (Addgene plasmid # 101276 ; http://n2t.net/addgene:101276 ; RRID:Addgene_101276) -
For your References section:
Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators. Chamberland S, Yang HH, Pan MM, Evans SW, Guan S, Chavarha M, Yang Y, Salesse C, Wu H, Wu JC, Clandinin TR, Toth K, Lin MZ, St-Pierre F. eLife. 2017 Jul 27;6. pii: e25690. doi: 10.7554/eLife.25690. 10.7554/eLife.25690 PubMed 28749338