Skip to main content

WPXL SOX10 gRNA
(Plasmid #101923)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101923 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    WPLX destination vector
  • Backbone size w/o insert (bp) 12806
  • Total vector size (bp) 11630
  • Modifications to backbone
    removed Puromycin selection and inserted Hygromycin
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SOX10 promoter targeting gRNA
  • gRNA/shRNA sequence
    CACAGTAAGAGAGACTTCTC
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCTCGACGGTATCGGTTAACTT
  • 3′ sequencing primer TACGGGAAGCAATAGCATGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    WPXL SOX10 gRNA was a gift from Danwei Huangfu (Addgene plasmid # 101923 ; http://n2t.net/addgene:101923 ; RRID:Addgene_101923)
  • For your References section:

    TET proteins safeguard bivalent promoters from de novo methylation in human embryonic stem cells. Verma N, Pan H, Dore LC, Shukla A, Li QV, Pelham-Webb B, Teijeiro V, Gonzalez F, Krivtsov A, Chang CJ, Papapetrou EP, He C, Elemento O, Huangfu D. Nat Genet. 2018 Jan;50(1):83-95. doi: 10.1038/s41588-017-0002-y. Epub 2017 Dec 4. 10.1038/s41588-017-0002-y PubMed 29203910