WPXL SOX10 gRNA
(Plasmid
#101923)
-
PurposeSOX10 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101923 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneWPLX destination vector
- Backbone size w/o insert (bp) 12806
- Total vector size (bp) 11630
-
Modifications to backboneremoved Puromycin selection and inserted Hygromycin
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSOX10 promoter targeting gRNA
-
gRNA/shRNA sequenceCACAGTAAGAGAGACTTCTC
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCTCGACGGTATCGGTTAACTT
- 3′ sequencing primer TACGGGAAGCAATAGCATGA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
WPXL SOX10 gRNA was a gift from Danwei Huangfu (Addgene plasmid # 101923 ; http://n2t.net/addgene:101923 ; RRID:Addgene_101923) -
For your References section:
TET proteins safeguard bivalent promoters from de novo methylation in human embryonic stem cells. Verma N, Pan H, Dore LC, Shukla A, Li QV, Pelham-Webb B, Teijeiro V, Gonzalez F, Krivtsov A, Chang CJ, Papapetrou EP, He C, Elemento O, Huangfu D. Nat Genet. 2018 Jan;50(1):83-95. doi: 10.1038/s41588-017-0002-y. Epub 2017 Dec 4. 10.1038/s41588-017-0002-y PubMed 29203910