Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSIN-PAmCherry-KFERQ-NE
(Plasmid #102365)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102365 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSin4-EF2-IRES-Pur
  • Backbone manufacturer
    SINF-EF-G (from Dr. Robert Hawley, George Washington University) was modified to make the lentiviral backbone.
  • Backbone size w/o insert (bp) 7500
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PA-mCherry
  • Species
    Synthetic
  • Promoter EF-1a

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer EF-1a Forward
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    KFERQ peptide
  • Species
    Synthetic
  • Insert Size (bp)
    825
  • Promoter EF-1a
  • Tag / Fusion Protein
    • NE (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer unknown
  • 3′ sequencing primer TTAGCTTTCGTTATCATCATAGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

"KFERQ" is the consensus peptide sequence found in various native proteins for mediating degradation via Chaperone-Mediated Autophagy (CMA)
There is a "NheI" restriction site which we artificially added between PAmCherry and KFERQ-NE to facilitate cloning. i.e. 5'---PAmCherry-NheI-KFERQ-NE----3'

This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIN-PAmCherry-KFERQ-NE was a gift from Shu Leong Ho (Addgene plasmid # 102365 ; http://n2t.net/addgene:102365 ; RRID:Addgene_102365)
  • For your References section:

    Age-dependent accumulation of oligomeric SNCA/alpha-synuclein from impaired degradation in mutant LRRK2 knockin mouse model of Parkinson disease: role for therapeutic activation of chaperone-mediated autophagy (CMA). Ho PW, Leung CT, Liu H, Pang SY, Lam CS, Xian J, Li L, Kung MH, Ramsden DB, Ho SL. Autophagy. 2019 Apr 14:1-24. doi: 10.1080/15548627.2019.1603545. 10.1080/15548627.2019.1603545 PubMed 30983487