pMSCV(W-)U6sgRNA5(BbsI)-PGKpuroBFP
(Plasmid
#102797)
-
PurposeRetrovirus for testing CRISPR KO activity (empty) - non-targeting control plasmid contains GFP instead of PuroR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102797 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMSCV
-
Vector typeMammalian Expression, Retroviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namesgRNA
-
Alt nameCCGGGTCTTCGAGAAGACAC
-
SpeciesSynthetic
Gene/Insert 2
-
Gene/Insert nameEGFP
-
MutationH231L
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Constructed by gibson assembly from pKLV2(W-)U6sgRNA5(BbsI)-PGKpuroBFP and pMSCV-IRES-mCherry FP. Used to verify CRISPR activity
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV(W-)U6sgRNA5(BbsI)-PGKpuroBFP was a gift from Sarah Teichmann (Addgene plasmid # 102797 ; http://n2t.net/addgene:102797 ; RRID:Addgene_102797) -
For your References section:
Genome-wide CRISPR Screens in T Helper Cells Reveal Pervasive Crosstalk between Activation and Differentiation. Henriksson J, Chen X, Gomes T, Ullah U, Meyer KB, Miragaia R, Duddy G, Pramanik J, Yusa K, Lahesmaa R, Teichmann SA. Cell. 2019 Jan 7. pii: S0092-8674(18)31569-1. doi: 10.1016/j.cell.2018.11.044. 10.1016/j.cell.2018.11.044 PubMed 30639098