Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMSCV(gfp)U6sgRNA5(BbsI)-PGKpuroBFP
(Plasmid #102798)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102798 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    sgRNA
  • Alt name
    GAAGTTCGAGGGCGACACCC
  • Species
    Synthetic

Gene/Insert 2

  • Gene/Insert name
    EGFP
  • Mutation
    H231L

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Constructed by gibson assembly from pKLV2(gfp)U6sgRNA5(BbsI)-PGKpuroBFP and pMSCV-IRES-mCherry FP. Used to verify CRISPR activity

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV(gfp)U6sgRNA5(BbsI)-PGKpuroBFP was a gift from Sarah Teichmann (Addgene plasmid # 102798 ; http://n2t.net/addgene:102798 ; RRID:Addgene_102798)
  • For your References section:

    Genome-wide CRISPR Screens in T Helper Cells Reveal Pervasive Crosstalk between Activation and Differentiation. Henriksson J, Chen X, Gomes T, Ullah U, Meyer KB, Miragaia R, Duddy G, Pramanik J, Yusa K, Lahesmaa R, Teichmann SA. Cell. 2019 Jan 7. pii: S0092-8674(18)31569-1. doi: 10.1016/j.cell.2018.11.044. 10.1016/j.cell.2018.11.044 PubMed 30639098