Skip to main content
Addgene

pC0052-REPAIR non-targeting guide clone into pC0043
(Plasmid #103868)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 103868 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pC0043-PspCas13b crRNA backbone
  • Backbone size w/o insert (bp) 2962
  • Total vector size (bp) 2969
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    non-targeting guide RNA
  • gRNA/shRNA sequence
    GTAATGCCTGGCTTGTCGACGCATAGTCTG

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC0052-REPAIR non-targeting guide clone into pC0043 was a gift from Feng Zhang (Addgene plasmid # 103868 ; http://n2t.net/addgene:103868 ; RRID:Addgene_103868)
  • For your References section:

    RNA editing with CRISPR-Cas13. Cox DBT, Gootenberg JS, Abudayyeh OO, Franklin B, Kellner MJ, Joung J, Zhang F. Science. 2017 Oct 25. pii: eaaq0180. doi: 10.1126/science.aaq0180. 10.1126/science.aaq0180 PubMed 29070703