-
PurposeNon-targeting guide RNA for use with PspCas13b. Useful as a control for RNA editing and RNA knockdown experiments.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 103868 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepC0043-PspCas13b crRNA backbone
- Backbone size w/o insert (bp) 2962
- Total vector size (bp) 2969
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenon-targeting guide RNA
-
gRNA/shRNA sequenceGTAATGCCTGGCTTGTCGACGCATAGTCTG
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Benchling link: https://benchling.com/s/seq-U9gHnOW41C1DVUBGQypw
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC0052-REPAIR non-targeting guide clone into pC0043 was a gift from Feng Zhang (Addgene plasmid # 103868 ; http://n2t.net/addgene:103868 ; RRID:Addgene_103868) -
For your References section:
RNA editing with CRISPR-Cas13. Cox DBT, Gootenberg JS, Abudayyeh OO, Franklin B, Kellner MJ, Joung J, Zhang F. Science. 2017 Oct 25. pii: eaaq0180. doi: 10.1126/science.aaq0180. 10.1126/science.aaq0180 PubMed 29070703