Skip to main content

pKM126
(Plasmid #105134)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105134 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJS116
  • Backbone size w/o insert (bp) 6324
  • Modifications to backbone
    Addition of Cas9 (codon optimized for C. difficile expression), tetR, region of homology for pyrE deletion, gRNA, gdh promoter
  • Vector type
    E. coli - C. difficile shuttle vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Upstream & Downstream pyrE deletion region
  • Species
    C. difficile
  • Insert Size (bp)
    2000

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caggaaacagctatgacc
  • 3′ sequencing primer tctgcaggcctcgag
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    tetR
  • Insert Size (bp)
    624

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctcgaggcctgcaga
  • 3′ sequencing primer caatgatataatgtcaacaaaaaggagga
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Cas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4107

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcttgatcgtagcgttaacagatc
  • 3′ sequencing primer tgtaaaacgacggccagt
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    gRNA
  • Insert Size (bp)
    140

Cloning Information for Gene/Insert 4

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKM126 was a gift from Joseph Sorg (Addgene plasmid # 105134 ; http://n2t.net/addgene:105134 ; RRID:Addgene_105134)
  • For your References section:

    Using CRISPR-Cas9-mediated genome editing to generate C. difficile mutants defective in selenoproteins synthesis. McAllister KN, Bouillaut L, Kahn JN, Self WT, Sorg JA. Sci Rep. 2017 Nov 7;7(1):14672. doi: 10.1038/s41598-017-15236-5. 10.1038/s41598-017-15236-5 [pii] PubMed 29116155