pBad-CA TAG126
(Plasmid
#105836)
-
PurposeExpresses thermostable variant of human carbonic anhydrase II with TAG stop codon at site 126 and C-terminal 6x his tag
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105836 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBad
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4100
- Total vector size (bp) 4900
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehuman carbonic anhydrase II thermostable variant
-
Alt nameHCAII
-
SpeciesH. sapiens (human)
-
Insert Size (bp)801
-
MutationTAG stop codon at site 126
-
Entrez GeneCA2 (a.k.a. CA-II, CAC, CAII, Car2, HEL-76, HEL-S-282)
- Promoter pBad/arabinose
-
Tag
/ Fusion Protein
- 6x his tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://openlibrary-repo.ecampusontario.ca/jspui/handle/123456789/838 for Chemical Biology & Biochemistry Laboratory Using Genetic Code Expansion Manual.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBad-CA TAG126 was a gift from Ryan Mehl (Addgene plasmid # 105836 ; http://n2t.net/addgene:105836 ; RRID:Addgene_105836) -
For your References section:
Chemical Biology & Biochemistry Laboratory : Using Genetic Code Expansion Manual. Mehl R, van Zee K, Kean K. 2020