pLenti- V6.3 lox-dsRED-stop-lox-eGFP-blas
(Plasmid #106171)

• Purpose: cre mediated red to green shift
• Depositing Lab: Ewa Snaar-Jagalska
• Publication: Heitzer et al Sci Rep. 2019 Mar 11;9(1):4096. doi: 10.1038/s41598-019-40570-1.

Backbone

• Vector backbone: pLenti6.3/TO/V5-DEST
• Backbone manufacturer: invitrogen
• Backbone size w/o insert (bp): 9351
• Total vector size (bp): 9185
• Modifications to backbone: lox-dsRED-STOP-lox-GFP (from plasmid(Plasmid #32702)) cloned in to pLenti 6.3 (through in-fusion cloning, linearized through PstI and SalI digestion, restriction sites maintained)
• Vector type: Mammalian Expression, Lentiviral, Cre/Lox
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: dsRED-express2
• Species: Synthetic
• Insert Size (bp): 678
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GTACTGGAACTGGGGGGACAG

Gene/Insert 2

• Gene/Insert name: eGFP
• Species: Synthetic
• Insert Size (bp): 717
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GGTCCTTCTTGAGTTTGTAAC
• 3′ sequencing primer: CCATCTAATTCAACAAGAATTGGGACAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: insert derived from plasmid (Plasmid #32702) pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry