-
Purposecre mediated red to green shift
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106171 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti6.3/TO/V5-DEST
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 9351
- Total vector size (bp) 9185
-
Modifications to backbonelox-dsRED-STOP-lox-GFP (from plasmid(Plasmid #32702)) cloned in to pLenti 6.3 (through in-fusion cloning, linearized through PstI and SalI digestion, restriction sites maintained)
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namedsRED-express2
-
SpeciesSynthetic
-
Insert Size (bp)678
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GTACTGGAACTGGGGGGACAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)717
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGTCCTTCTTGAGTTTGTAAC
- 3′ sequencing primer CCATCTAATTCAACAAGAATTGGGACAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byinsert derived from plasmid (Plasmid #32702) pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti- V6.3 lox-dsRED-stop-lox-eGFP-blas was a gift from Ewa Snaar-Jagalska (Addgene plasmid # 106171 ; http://n2t.net/addgene:106171 ; RRID:Addgene_106171) -
For your References section:
Human melanoma brain metastases cell line MUG-Mel1, isolated clones and their detailed characterization. Heitzer E, Groenewoud A, Meditz K, Lohberger B, Liegl-Atzwanger B, Prokesch A, Kashofer K, Behrens D, Haybaeck J, Kolb-Lenz D, Koefeler H, Riedl S, Schaider H, Fischer C, Snaar-Jagalska BE, de'Jong D, Szuhai K, Zweytick D, Rinner B. Sci Rep. 2019 Mar 11;9(1):4096. doi: 10.1038/s41598-019-40570-1. 10.1038/s41598-019-40570-1 PubMed 30858407