Skip to main content

pSBbi-FoxO1_1R_13A_3D
(Plasmid #106279)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106279 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSBbi-RP
  • Backbone size w/o insert (bp) 6625
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Foxo1a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1900
  • Mutation
    Deleted amino acids 401-636, T24A, S209A, H212R, S215A, S246A, S253A, S284A, S295A, S298A, S300A, S316A, L325D, S325D, P325D, S380A, S391A, T399A
  • Entrez Gene
    Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
  • Promoter EF1a/RPBSA
  • Tag / Fusion Protein
    • Clover fluorescent protein (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site - (unknown if destroyed)
  • 3′ cloning site - (unknown if destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    NLS-mCherry-NLS-P2A-Puromycin
  • Insert Size (bp)
    1450
  • Promoter EF1a/RPBSA
  • Tag / Fusion Protein
    • NLS (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site - (unknown if destroyed)
  • 3′ cloning site - (unknown if destroyed)
  • 5′ sequencing primer 1
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBbi-FoxO1_1R_13A_3D was a gift from Laura Heiser (Addgene plasmid # 106279 ; http://n2t.net/addgene:106279 ; RRID:Addgene_106279)
  • For your References section:

    Individual Cells Can Resolve Variations in Stimulus Intensity along the IGF-PI3K-AKT Signaling Axis. Gross SM, Dane MA, Bucher E, Heiser LM. Cell Syst. 2019 Dec 18;9(6):580-588.e4. doi: 10.1016/j.cels.2019.11.005. Epub 2019 Dec 11. 10.1016/j.cels.2019.11.005 PubMed 31838146