pSBbi-FoxO1_1R_13A_3D
(Plasmid
#106279)
-
PurposeFluorescent fusion protein for FoxO1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106279 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSBbi-RP
- Backbone size w/o insert (bp) 6625
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFoxo1a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1900
-
MutationDeleted amino acids 401-636, T24A, S209A, H212R, S215A, S246A, S253A, S284A, S295A, S298A, S300A, S316A, L325D, S325D, P325D, S380A, S391A, T399A
-
Entrez GeneFoxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
- Promoter EF1a/RPBSA
-
Tag
/ Fusion Protein
- Clover fluorescent protein (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site - (unknown if destroyed)
- 3′ cloning site - (unknown if destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNLS-mCherry-NLS-P2A-Puromycin
-
Insert Size (bp)1450
- Promoter EF1a/RPBSA
-
Tag
/ Fusion Protein
- NLS (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site - (unknown if destroyed)
- 3′ cloning site - (unknown if destroyed)
- 5′ sequencing primer 1 (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/07/21/373993 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBbi-FoxO1_1R_13A_3D was a gift from Laura Heiser (Addgene plasmid # 106279 ; http://n2t.net/addgene:106279 ; RRID:Addgene_106279) -
For your References section:
Individual Cells Can Resolve Variations in Stimulus Intensity along the IGF-PI3K-AKT Signaling Axis. Gross SM, Dane MA, Bucher E, Heiser LM. Cell Syst. 2019 Dec 18;9(6):580-588.e4. doi: 10.1016/j.cels.2019.11.005. Epub 2019 Dec 11. 10.1016/j.cels.2019.11.005 PubMed 31838146