-
PurposeBacterial Expression plasmid for potassium ion raitometric indicator KIRIN1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107414 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKIRIN1
-
Alt nameKCY1
-
SpeciesSynthetic
-
Insert Size (bp)1878
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/01/26/254383 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-KIRIN1 was a gift from Robert Campbell (Addgene plasmid # 107414 ; http://n2t.net/addgene:107414 ; RRID:Addgene_107414) -
For your References section:
Genetically encoded fluorescent indicators for imaging intracellular potassium ion concentration. Shen Y, Wu SY, Rancic V, Aggarwal A, Qian Y, Miyashita SI, Ballanyi K, Campbell RE, Dong M. Commun Biol. 2019 Jan 14;2:18. doi: 10.1038/s42003-018-0269-2. eCollection 2019. 10.1038/s42003-018-0269-2 PubMed 30652129