Skip to main content

pBAD-GINKO1
(Plasmid #113111)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113111 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pBAD
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GINKO1
  • Species
    Synthetic
  • Promoter araBAD
  • Tags / Fusion Proteins
    • 6-His Tag (N terminal on backbone)
    • T7 tag (gene 10 leader) (N terminal on backbone)
    • Xpress™ tag (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-GINKO1 was a gift from Robert Campbell (Addgene plasmid # 113111 ; http://n2t.net/addgene:113111 ; RRID:Addgene_113111)
  • For your References section:

    Genetically encoded fluorescent indicators for imaging intracellular potassium ion concentration. Shen Y, Wu SY, Rancic V, Aggarwal A, Qian Y, Miyashita SI, Ballanyi K, Campbell RE, Dong M. Commun Biol. 2019 Jan 14;2:18. doi: 10.1038/s42003-018-0269-2. eCollection 2019. 10.1038/s42003-018-0269-2 PubMed 30652129