pBV65
(Plasmid
#108363)
-
PurposeA nourseothricin resistance marker used to construct gene disruptions in Candida glabrata. The natMX6 marker can be evicted by growth on media lacking methionine and containing estradiol.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFA6a
- Backbone size w/o insert (bp) 2468
- Total vector size (bp) 8096
-
Modifications to backboneloxP sites flank insert
-
Vector typeGene disruption marker for Candida glabrata
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameloxP-natMX6-CgMET3prom-cre-loxP
-
Alt nameRecyclable nat cassette
-
SpeciesCandida glabrata
- Promoter C. glabrata MET3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtacgctgcaggtcgacaac
- 3′ sequencing primer gccactagtggatctgatatcacc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBV65 was a gift from Scott Moye-Rowley (Addgene plasmid # 108363 ; http://n2t.net/addgene:108363 ; RRID:Addgene_108363) -
For your References section:
Construction and Use of a Recyclable Marker To Examine the Role of Major Facilitator Superfamily Protein Members in Candida glabrata Drug Resistance Phenotypes. Vu BG, Moye-Rowley WS. mSphere. 2018 Mar 28;3(2). pii: mSphere00099-18. doi: 10.1128/mSphere.00099-18. eCollection 2018 Mar-Apr. 10.1128/mSphere.00099-18 PubMed 29600281