-
PurposeExpression of drug-inducible dSpyCas9-mCherry-APEX2 for biotin-labeling genomic element-associated protein factors
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108570 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE-DEST
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 12774
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedSpyCas9
-
SpeciesSynthetic
-
Insert Size (bp)4113
- Promoter CMV
-
Tags
/ Fusion Proteins
- Destabilization domains (N terminal on insert)
- mCherry (C terminal on insert)
- Flag (C terminal on insert)
- APEX2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypHAGE-TO-DD-dCas9-mCherry was a gift from David Grunwald lab (published in Ma et al J. Cell Biol. 2016).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CRISPR-Cas9 nuclear dynamics and target recognition in living cells. Ma, H., Tu, L.-C., Naseri, A., Huisman, M., Zhang, S., Grunwald, D., and Pederson, T. (2016). CRISPR-Cas9 nuclear dynamics and target recognition in living cells. The Journal of Cell Biology 214, 529–537.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEJS578_DD-dSpyCas9-mCherry-APEX2 was a gift from Erik Sontheimer (Addgene plasmid # 108570 ; http://n2t.net/addgene:108570 ; RRID:Addgene_108570) -
For your References section:
C-BERST: defining subnuclear proteomic landscapes at genomic elements with dCas9-APEX2. Gao XD, Tu LC, Mir A, Rodriguez T, Ding Y, Leszyk J, Dekker J, Shaffer SA, Zhu LJ, Wolfe SA, Sontheimer EJ. Nat Methods. 2018 Jun;15(6):433-436. doi: 10.1038/s41592-018-0006-2. Epub 2018 May 7. 10.1038/s41592-018-0006-2 PubMed 29735996