pGEX6P1‐Afu‐rnhBΔPIP
(Plasmid
#108696)
-
PurposeFor expression in E. coli, and affinity purification of N-terminally GST-tagged Archaeoglobus fulgidus RNase HII with C-terminal PIP box deletion
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108696 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGEX6P1
-
Backbone manufacturerAmersham
- Backbone size w/o insert (bp) 4984
- Total vector size (bp) 5579
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namernhB
-
SpeciesArchaeoglobus fulgidus
-
Insert Size (bp)597
-
MutationC-terminal truncation (7aa) removing PIP box
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX6P1‐Afu‐rnhBΔPIP was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108696 ; http://n2t.net/addgene:108696 ; RRID:Addgene_108696) -
For your References section:
PCNA directs type 2 RNase H activity on DNA replication and repair substrates. Bubeck D, Reijns MA, Graham SC, Astell KR, Jones EY, Jackson AP. Nucleic Acids Res. 2011 May;39(9):3652-66. doi: 10.1093/nar/gkq980. Epub 2011 Jan 17. 10.1093/nar/gkq980 PubMed 21245041