-
PurposeMitochondria targetting gTEMP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109117 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemito-gTEMP
-
Alt namemitochondria targetting gTEMP
-
SpeciesSynthetic
-
Insert Size (bp)1929
-
GenBank ID
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCTAACTAGAGAACCCACTGCTTAC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mito-gTEMP_pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 109117 ; http://n2t.net/addgene:109117 ; RRID:Addgene_109117) -
For your References section:
Genetically encoded ratiometric fluorescent thermometer with wide range and rapid response. Nakano M, Arai Y, Kotera I, Okabe K, Kamei Y, Nagai T. PLoS One. 2017 Feb 17;12(2):e0172344. doi: 10.1371/journal.pone.0172344. eCollection 2017. PONE-D-16-44541 [pii] PubMed 28212432