-
Purposevirus packaged, doxycyline inducible expression of Cyclin E1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109348 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepInducer20
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCyclin E1
-
SpeciesH. sapiens (human)
-
GenBank IDNP_001309191.1
-
Entrez GeneCCNE1 (a.k.a. CCNE, pCCNE1)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCATAGAAGACACCGGGACC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pInducer20 Cyclin E1 was a gift from Jean Cook (Addgene plasmid # 109348 ; http://n2t.net/addgene:109348 ; RRID:Addgene_109348) -
For your References section:
Rapid DNA replication origin licensing protects stem cell pluripotency. Matson JP, Dumitru R, Coryell P, Baxley RM, Chen W, Twaroski K, Webber BR, Tolar J, Bielinsky AK, Purvis JE, Cook JG. Elife. 2017 Nov 17;6. doi: 10.7554/eLife.30473. 10.7554/eLife.30473 PubMed 29148972