-
PurposeTo visualize free autophagosomes (GFP and mCherry fluorescence) and autophagosomes that have fused with the lysosome (autolyosomes; mCherry fluorescence only, due to acid sensitivity of GFP)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110060 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFUW
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsPlasmid may be prone to recombination. Select small colonies and/or screen multiple colonies.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry-GFP-LC3
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer CGCGGATCCGGTCGCCACCATGGTGAGCAAGGGCGAG
- 3′ sequencing primer CGCGGCGCGCCGCTGGGTCTAGATGCATGC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byDr. Malene Hansen
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUW mCherry-GFP-LC3 was a gift from Anne Brunet (Addgene plasmid # 110060 ; http://n2t.net/addgene:110060 ; RRID:Addgene_110060) -
For your References section:
Lysosome activation clears aggregates and enhances quiescent neural stem cell activation during aging. Leeman DS, Hebestreit K, Ruetz T, Webb AE, McKay A, Pollina EA, Dulken BW, Zhao X, Yeo RW, Ho TT, Mahmoudi S, Devarajan K, Passegue E, Rando TA, Frydman J, Brunet A. Science. 2018 Mar 16;359(6381):1277-1283. doi: 10.1126/science.aag3048. Epub 2018 Mar 15. 10.1126/science.aag3048 PubMed 29590078