Skip to main content

Human CRISPR Metabolic Gene Knockout Library
(Pooled Library #110066, #110066-LV)

  • Purpose

    This lentiviral CRISPR library targets 2,981 human metabolic genes with 29,790 guide RNAs plus 500 intergenic controls. The library contains ~10 gRNAs per gene.

  • Vector Backbone

    lentiCRISPR v1 (Plasmid #49535) - expresses Cas9

    Note: This plasmid has been discontinued, as an updated version is available. For confirmation of screen hits, Addgene encourages recipient scientists to use the updated lentiCRISPR v2 (Plasmid #52961), which can be requested separately.

Ordering

Item Catalog # Description Quantity Price (USD)
Pooled Library 110066 Human CRISPR Metabolic Gene KO Library 1 $511 Add to Cart
Lentiviral Prep 110066-LV Limited Stock Available, 4 units left
Virus (1.1×108 TU, titer ≥ 2×106 TU/mL) and Pooled Library DNA More Information
1 $2353 Add to Cart
Available to Academic and Nonprofits Only

Library Details

  • Species
    Human
  • Genes targeted
    2,981
  • Total gRNAs
    30,290
  • Controls
    500 intergenic
  • Lentiviral Generation
    3rd

Library Shipping

This library is delivered as suspended DNA in a microcentrifuge tube on blue ice. The tube's contents will not necessarily be frozen. For best results, minimize freeze/thaws.

  • Volume
    ∼20 µL
  • Concentration
    50 ng/µL

Resource Information

Depositor Comments

Library screening is performed by comparing sgRNA abundance of an initial cell population and a final cell population after cell growth, using massively parallel sequencing.

Figure 1: Overview of library screening process.

When performing sgRNA validation in a Cas9-expressing cell line, the depositing laboratory recommends using plasmid pLenti-sgRNA (Addgene #71409).

Information for Lentiviral Prep (Catalog # 110066-LV) ( Back to top )

Purpose

Ready-to-use lentiviral pooled library for CRISPR screening in human cells. Contains 29,790 gRNAs, targeting 2,981 genes. Lentiviral particles carrying human CRISPR metabolic gene knockout library in lentiCRISPR v1.

Delivery

  • Volume Varies depending on titer.
  • Titer ≥ 2 × 106 TU/mL
  • Storage Store at -80 °C. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Pooled Library DNA (10 µL at 50 ng/µL) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer OptiPRO SFM
  • Selectable Marker Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Pooled Library Representation:
  • To confirm library representation and distribution, we perform next-generation sequencing on the purified plasmid DNA pool that was used to generate lentivirus.

Titering Method:
  • ddPCR: 293T cells are transduced with serial dilutions of 110066-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.
PCR confirmation of insert:
  • PCR was carried out with primers targeting Cas9 and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
    • Forward primer: CCAAAGAGGTGCTGGACG
    • Reverse Primer: GCAGAATCCAGGTGGCAACA

Visit our viral production page for more information.

Addgene Comments

Shipment specifications:

Pooled libraries containing at least 1.1 × 108 infectious units are shipped on dry ice at a titer of ≥ 2 × 106 TU/mL. The total volume is divided among several large aliquots and one 1.3 mL aliquot for testing. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

How to use this virus:

We recommend using the testing aliquot of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in the original publication. Before using this virus, Addgene strongly recommends reading the original publication (Birsoy et al., 2015 (Link opens in a new window)).

How to use the virus associated DNA:

Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

How to cite this pooled library ( Back to top )

These pooled libraries were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human CRISPR Metabolic Gene Knockout library was a gift from David Sabatini (Addgene #110066 ; http://n2t.net/addgene:110066 ; RRID:Addgene_110066)
    Human CRISPR Metabolic Gene Knockout library was a gift from David Sabatini (Addgene #110066-LV ; http://n2t.net/addgene:110066-LV ; RRID:Addgene_110066-LV)
  • For your References section:

    An Essential Role of the Mitochondrial Electron Transport Chain in Cell Proliferation Is to Enable Aspartate Synthesis. Birsoy K, Wang T, Chen WW, Freinkman E, Abu-Remaileh M, Sabatini DM. Cell. 2015 Jul 30;162(3):540-51. doi: 10.1016/j.cell.2015.07.016. PubMed 26232224 (Link opens in a new window)