pCZ829
(Plasmid
#110137)
-
PurposeEpidermal Mitochondrial-tagged Florescent Calcium Sensor
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110137 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCFJ210
- Backbone size w/o insert (bp) 9200
- Total vector size (bp) 11103
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemito-GCaMP5
-
SpeciesSynthetic
- Promoter Pcol-19
-
Tag
/ Fusion Protein
- mito::GCaMP5
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTACCAGAGCTCACCTAGG
- 3′ sequencing primer GACTCACTAGTGGGCAGATC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCZ829 was a gift from Andrew Chisholm (Addgene plasmid # 110137 ; http://n2t.net/addgene:110137 ; RRID:Addgene_110137) -
For your References section:
C. elegans epidermal wounding induces a mitochondrial ROS burst that promotes wound repair. Xu S, Chisholm AD. Dev Cell. 2014 Oct 13;31(1):48-60. doi: 10.1016/j.devcel.2014.08.002. 10.1016/j.devcel.2014.08.002 PubMed 25313960