Skip to main content

pSET-dCas9
(Plasmid #110183)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110183 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSET152
  • Backbone size w/o insert (bp) 5715
  • Total vector size (bp) 10158
  • Vector type
    Bacterial Expression, CRISPR ; i

Growth in Bacteria

  • Bacterial Resistance(s)
    Apramycin, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9
  • Species
    Synthetic; artificially synthesized, codon optimized gene from S. pyogenes
  • Insert Size (bp)
    4107
  • Mutation
    D10A, H840A
  • Promoter ermE*p

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site EcoRV (unknown if destroyed)
  • 5′ sequencing primer pSET152-F (GATGTAGGAGGGCGTGGATATG)
  • 3′ sequencing primer pSET152-R (CCCAATACGCAAACCGCCTC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSET-dCas9 was a gift from Yinhua Lu (Addgene plasmid # 110183 ; http://n2t.net/addgene:110183 ; RRID:Addgene_110183)
  • For your References section:

    CRISPR/dCas9-Mediated Multiplex Gene Repression in Streptomyces. Zhao Y, Li L, Zheng G, Jiang W, Deng Z, Wang Z, Lu Y. Biotechnol J. 2018 Jun 3. doi: 10.1002/biot.201800121. 10.1002/biot.201800121 PubMed 29862648