pCFD3-ovoD1
(Plasmid
#111142)
-
PurposeExpresses U6:3-sgRNA targeting ovoD1 mutation in Drosophila melanogaster
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111142 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCFD3
- Backbone size w/o insert (bp) 6230
- Total vector size (bp) 6250
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepCFD3-ovoD1
-
gRNA/shRNA sequenceAAAAAGAGATGCCCGCAGAG
-
SpeciesD. melanogaster (fly)
-
Entrez Geneovo (a.k.a. Dmel_CG6824, CG15467, CG6824, Dmel\CG6824, Fs(1)K1103, Fs(1)K1237, Fs(1)K155, OVO, Ovo, Ovo-D, Shv, Svb, Svb/Ovo, fs(1)K1237, fs(1)M1, fs(1)M38, ovo/shavenbaby, ovo/svb, ovoD, svb, svb/ovo)
- Promoter U6:3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer TCGAAAATTTTTGAATAGCCCAGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD3-ovoD1 was a gift from Norbert Perrimon (Addgene plasmid # 111142 ; http://n2t.net/addgene:111142 ; RRID:Addgene_111142) -
For your References section:
ovo(D) Co-selection: A Method for Enriching CRISPR/Cas9-Edited Alleles in Drosophila. Ewen-Campen B, Perrimon N. G3 (Bethesda). 2018 Jul 31;8(8):2749-2756. doi: 10.1534/g3.118.200498. 10.1534/g3.118.200498 PubMed 29934375