p006-Banana-Late
(Plasmid
#112251)
-
PurposeATF1 from Saccharomyces cerevisiae under osmY stationary phase promoter; kanamycin resistant.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJ401
-
Backbone manufacturerDNA2.0
- Backbone size w/o insert (bp) 3541
- Total vector size (bp) 4646
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATF1 under osmY promoter
-
Alt nameBanana odour generator
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1803
- Promoter osmY
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCGAAAATAATAAAGGGAAAATCAGT
- 3′ sequencing primer CTCAGAAGTGAAACGCCGTA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe gene was synthesized by LifeTechnologies and/or IDTDNA
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.06.20.449138v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p006-Banana-Late was a gift from Jaroslaw Bryk (Addgene plasmid # 112251 ; http://n2t.net/addgene:112251 ; RRID:Addgene_112251) -
For your References section:
UNIGEMS: plasmids and parts to facilitate teaching on assembly, gene expression control and logic in E. coli. Siddall A, Williams AA, Sanders J, Denton JA, Madden D, Schollar J, Bryk J. bioRxiv 2021.06.20.449138 10.1101/2021.06.20.449138