gRNA[bTub].1026C
(Plasmid
#112691)
-
Purposeexpress gRNA targeting bTub under dU6-3 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112691 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonewhite+attB
-
Vector typeCRISPR
-
Selectable markersmini-white
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6.3-gRNA[bTub]
-
gRNA/shRNA sequenceCCTGAGTGTGCATCAGCTGG
-
SpeciesD. melanogaster (fly)
- Promoter dU6-3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNA[bTub].1026C was a gift from Omar Akbari (Addgene plasmid # 112691 ; http://n2t.net/addgene:112691 ; RRID:Addgene_112691) -
For your References section:
Transforming insect population control with precision guided sterile males with demonstration in flies. Kandul NP, Liu J, Sanchez C HM, Wu SL, Marshall JM, Akbari OS. Nat Commun. 2019 Jan 8;10(1):84. doi: 10.1038/s41467-018-07964-7. 10.1038/s41467-018-07964-7 PubMed 30622266