Skip to main content

pET21a.MJ0285
(Plasmid #11304)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11304 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET21a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5443
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    small heat shock protein
  • Species
    M. jannaschii
  • Insert Size (bp)
    441
  • GenBank ID
    AAB98273 Q57733
  • Entrez Gene
    MJ_0285 (a.k.a. MJ_0285, MJ0285)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Nature. 1998. 394:595-599;

Proc. Natl. Acad. Sciences. 1998. 95:9129-9133

Please note that the plasmid pET21a.MJ0285 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET21a.MJ0285 was a gift from Sung-Hou Kim (Addgene plasmid # 11304 ; http://n2t.net/addgene:11304 ; RRID:Addgene_11304)
  • For your References section:

    Purification, crystallization, and preliminary X-ray crystallographic data analysis of small heat shock protein homolog from Methanococcus jannaschii, a hyperthermophile. Kim KK, Yokota H, Santoso S, Lerner D, Kim R, Kim SH. J Struct Biol. 1998 Jan . 121(1):76-80. 10.1006/jsbi.1998.3969 PubMed 9573624