- 
            PurposeBacterial expression of genetically encoded green fluorescent potassium ion indicator GINKO1
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113111 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepBAD
- 
              Vector typeBacterial Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameGINKO1
- 
                    SpeciesSynthetic
- Promoter araBAD
- 
    
        Tags
        / Fusion Proteins
    - 6-His Tag (N terminal on backbone)
- T7 tag (gene 10 leader) (N terminal on backbone)
- Xpress™ tag (N terminal on backbone)
 
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pBAD-GINKO1 was a gift from Robert Campbell (Addgene plasmid # 113111 ; http://n2t.net/addgene:113111 ; RRID:Addgene_113111)
- 
                For your References section: Genetically encoded fluorescent indicators for imaging intracellular potassium ion concentration. Shen Y, Wu SY, Rancic V, Aggarwal A, Qian Y, Miyashita SI, Ballanyi K, Campbell RE, Dong M. Commun Biol. 2019 Jan 14;2:18. doi: 10.1038/s42003-018-0269-2. eCollection 2019. 10.1038/s42003-018-0269-2 PubMed 30652129
