Skip to main content

pLenti NL
(Plasmid #113450)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113450 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FUGW
  • Backbone manufacturer
    FUGW was a gift from David Baltimore (Addgene plasmid # 14883)
  • Total vector size (bp) 9786
  • Vector type
    Mammalian Expression, Lentiviral, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NanoLuc
  • Insert Size (bp)
    510
  • Promoter hUbC
  • Tag / Fusion Protein
    • cmyc (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tgaagctccggttttgaact
  • 3′ sequencing primer ggcattaaagcagcgtatcc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Viral Core Facility (VCF) of the Charité – Universitätsmedizin Berlin
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti NL was a gift from Erich Wanker (Addgene plasmid # 113450 ; http://n2t.net/addgene:113450 ; RRID:Addgene_113450)
  • For your References section:

    LuTHy: a double-readout bioluminescence-based two-hybrid technology for quantitative mapping of protein-protein interactions in mammalian cells. Trepte P, Kruse S, Kostova S, Hoffmann S, Buntru A, Tempelmeier A, Secker C, Diez L, Schulz A, Klockmeier K, Zenkner M, Golusik S, Rau K, Schnoegl S, Garner CC, Wanker EE. Mol Syst Biol. 2018 Jul 11;14(7):e8071. doi: 10.15252/msb.20178071. 10.15252/msb.20178071 PubMed 29997244